Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634018_at:

>probe:Drosophila_2:1634018_at:302:167; Interrogation_Position=513; Antisense; AAATGCAATCCTTCGGTATGATCGA
>probe:Drosophila_2:1634018_at:573:615; Interrogation_Position=516; Antisense; TGCAATCCTTCGGTATGATCGAGCT
>probe:Drosophila_2:1634018_at:166:235; Interrogation_Position=519; Antisense; AATCCTTCGGTATGATCGAGCTCTT
>probe:Drosophila_2:1634018_at:4:627; Interrogation_Position=521; Antisense; TCCTTCGGTATGATCGAGCTCTTTT
>probe:Drosophila_2:1634018_at:315:717; Interrogation_Position=524; Antisense; TTCGGTATGATCGAGCTCTTTTTCG
>probe:Drosophila_2:1634018_at:30:287; Interrogation_Position=526; Antisense; CGGTATGATCGAGCTCTTTTTCGAG
>probe:Drosophila_2:1634018_at:610:117; Interrogation_Position=537; Antisense; AGCTCTTTTTCGAGGCACTCGTCGA
>probe:Drosophila_2:1634018_at:14:641; Interrogation_Position=540; Antisense; TCTTTTTCGAGGCACTCGTCGAAGT
>probe:Drosophila_2:1634018_at:311:699; Interrogation_Position=543; Antisense; TTTTCGAGGCACTCGTCGAAGTGAC
>probe:Drosophila_2:1634018_at:45:719; Interrogation_Position=545; Antisense; TTCGAGGCACTCGTCGAAGTGACGC
>probe:Drosophila_2:1634018_at:303:439; Interrogation_Position=548; Antisense; GAGGCACTCGTCGAAGTGACGCAGA
>probe:Drosophila_2:1634018_at:612:567; Interrogation_Position=550; Antisense; GGCACTCGTCGAAGTGACGCAGAAA
>probe:Drosophila_2:1634018_at:148:501; Interrogation_Position=557; Antisense; GTCGAAGTGACGCAGAAAACGTTCT
>probe:Drosophila_2:1634018_at:571:371; Interrogation_Position=560; Antisense; GAAGTGACGCAGAAAACGTTCTGAG

Paste this into a BLAST search page for me
AAATGCAATCCTTCGGTATGATCGATGCAATCCTTCGGTATGATCGAGCTAATCCTTCGGTATGATCGAGCTCTTTCCTTCGGTATGATCGAGCTCTTTTTTCGGTATGATCGAGCTCTTTTTCGCGGTATGATCGAGCTCTTTTTCGAGAGCTCTTTTTCGAGGCACTCGTCGATCTTTTTCGAGGCACTCGTCGAAGTTTTTCGAGGCACTCGTCGAAGTGACTTCGAGGCACTCGTCGAAGTGACGCGAGGCACTCGTCGAAGTGACGCAGAGGCACTCGTCGAAGTGACGCAGAAAGTCGAAGTGACGCAGAAAACGTTCTGAAGTGACGCAGAAAACGTTCTGAG

Full Affymetrix probeset data:

Annotations for 1634018_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime