FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634019_at:

>probe:Drosophila_2:1634019_at:364:77; Interrogation_Position=1040; Antisense; AGGTTGCCAAGTTCCTGTGGGCCGA
>probe:Drosophila_2:1634019_at:76:669; Interrogation_Position=1155; Antisense; TACTAGCTGCTGTTTCACGAACGGA
>probe:Drosophila_2:1634019_at:349:87; Interrogation_Position=631; Antisense; AGTCGCATTGTCGTTGTGTCCAGTC
>probe:Drosophila_2:1634019_at:275:51; Interrogation_Position=662; Antisense; ATGCGCGTGGCTCCATTAACGTAGC
>probe:Drosophila_2:1634019_at:541:485; Interrogation_Position=682; Antisense; GTAGCCGACCTCAACAGCGAGAAGT
>probe:Drosophila_2:1634019_at:409:217; Interrogation_Position=703; Antisense; AAGTCGTATGATGAGGGCCTAGCCT
>probe:Drosophila_2:1634019_at:457:331; Interrogation_Position=791; Antisense; GCGGAGTCACAGTAAATGCCCTTCA
>probe:Drosophila_2:1634019_at:649:561; Interrogation_Position=845; Antisense; GGAACTGGGCCTTCTTCCAGACAAA
>probe:Drosophila_2:1634019_at:429:459; Interrogation_Position=897; Antisense; GATTTGGCCGCTTTTAAAGACACCG
>probe:Drosophila_2:1634019_at:278:375; Interrogation_Position=921; Antisense; GAAGAGTGGAGCTCAGACCTCGATT
>probe:Drosophila_2:1634019_at:443:103; Interrogation_Position=935; Antisense; AGACCTCGATTTACGCTGCTTTGGA
>probe:Drosophila_2:1634019_at:409:335; Interrogation_Position=949; Antisense; GCTGCTTTGGATCCGGAGCTTAAGA
>probe:Drosophila_2:1634019_at:267:343; Interrogation_Position=966; Antisense; GCTTAAGAACATCTCTGGCCTGTAC
>probe:Drosophila_2:1634019_at:568:581; Interrogation_Position=981; Antisense; TGGCCTGTACTTCAGTGACTGCAAA

Paste this into a BLAST search page for me
AGGTTGCCAAGTTCCTGTGGGCCGATACTAGCTGCTGTTTCACGAACGGAAGTCGCATTGTCGTTGTGTCCAGTCATGCGCGTGGCTCCATTAACGTAGCGTAGCCGACCTCAACAGCGAGAAGTAAGTCGTATGATGAGGGCCTAGCCTGCGGAGTCACAGTAAATGCCCTTCAGGAACTGGGCCTTCTTCCAGACAAAGATTTGGCCGCTTTTAAAGACACCGGAAGAGTGGAGCTCAGACCTCGATTAGACCTCGATTTACGCTGCTTTGGAGCTGCTTTGGATCCGGAGCTTAAGAGCTTAAGAACATCTCTGGCCTGTACTGGCCTGTACTTCAGTGACTGCAAA

Full Affymetrix probeset data:

Annotations for 1634019_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720