FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634020_at:

>probe:Drosophila_2:1634020_at:405:609; Interrogation_Position=4684; Antisense; TGAGCAACATTTGCCTCATCGACAG
>probe:Drosophila_2:1634020_at:98:255; Interrogation_Position=4731; Antisense; CAACAACCATTGACTACAACAGCGT
>probe:Drosophila_2:1634020_at:126:665; Interrogation_Position=4745; Antisense; TACAACAGCGTCAATCATCTAATAG
>probe:Drosophila_2:1634020_at:131:351; Interrogation_Position=4829; Antisense; GCAGATGCAACTATACCAAATGGGC
>probe:Drosophila_2:1634020_at:244:393; Interrogation_Position=4945; Antisense; TGAAAAGGTCGAGCTCCTATTTTTT
>probe:Drosophila_2:1634020_at:511:301; Interrogation_Position=4974; Antisense; CCCGTTTATCTGTATAGTCCCCTAT
>probe:Drosophila_2:1634020_at:632:19; Interrogation_Position=4987; Antisense; ATAGTCCCCTATCAACGTTCGAATT
>probe:Drosophila_2:1634020_at:507:253; Interrogation_Position=4999; Antisense; CAACGTTCGAATTCTTAAAGCTGAT
>probe:Drosophila_2:1634020_at:211:119; Interrogation_Position=5017; Antisense; AGCTGATCAAATCTGCGGCTGCACA
>probe:Drosophila_2:1634020_at:367:335; Interrogation_Position=5034; Antisense; GCTGCACAGACTCGCTCTATATATA
>probe:Drosophila_2:1634020_at:690:21; Interrogation_Position=5054; Antisense; ATATATGGAGTACAGCTGGAGGCAA
>probe:Drosophila_2:1634020_at:80:229; Interrogation_Position=5078; Antisense; AATGCAATGCGTTGAATGCGACTTG
>probe:Drosophila_2:1634020_at:615:187; Interrogation_Position=5125; Antisense; AACACGAGAAACGTTGCCGCTGCAA
>probe:Drosophila_2:1634020_at:610:719; Interrogation_Position=5138; Antisense; TTGCCGCTGCAACCGTATGAAACAC

Paste this into a BLAST search page for me
TGAGCAACATTTGCCTCATCGACAGCAACAACCATTGACTACAACAGCGTTACAACAGCGTCAATCATCTAATAGGCAGATGCAACTATACCAAATGGGCTGAAAAGGTCGAGCTCCTATTTTTTCCCGTTTATCTGTATAGTCCCCTATATAGTCCCCTATCAACGTTCGAATTCAACGTTCGAATTCTTAAAGCTGATAGCTGATCAAATCTGCGGCTGCACAGCTGCACAGACTCGCTCTATATATAATATATGGAGTACAGCTGGAGGCAAAATGCAATGCGTTGAATGCGACTTGAACACGAGAAACGTTGCCGCTGCAATTGCCGCTGCAACCGTATGAAACAC

Full Affymetrix probeset data:

Annotations for 1634020_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720