Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634023_at:

>probe:Drosophila_2:1634023_at:337:537; Interrogation_Position=452; Antisense; GGTCTCTATCGCATTACTTTCTAAG
>probe:Drosophila_2:1634023_at:322:659; Interrogation_Position=473; Antisense; TAAGAGCACTGAAACCCACTGGCCA
>probe:Drosophila_2:1634023_at:453:121; Interrogation_Position=528; Antisense; AGCGGATCAGGCACGCGACGAGTTC
>probe:Drosophila_2:1634023_at:275:401; Interrogation_Position=557; Antisense; GACATGGTATCGCTGACTTCGTCAC
>probe:Drosophila_2:1634023_at:335:685; Interrogation_Position=586; Antisense; TATCACCGGGACGTTTGCAATCTGG
>probe:Drosophila_2:1634023_at:698:359; Interrogation_Position=602; Antisense; GCAATCTGGGCTTTGGTGCGGAACT
>probe:Drosophila_2:1634023_at:482:227; Interrogation_Position=634; Antisense; AAGGCCGATGCGGTCTTCTTGGATC
>probe:Drosophila_2:1634023_at:673:375; Interrogation_Position=702; Antisense; GAAGCTGTCCGGAGGTCGTTTCTGT
>probe:Drosophila_2:1634023_at:576:717; Interrogation_Position=726; Antisense; TTCGTTTTCGCCCTGCATTGAGCAG
>probe:Drosophila_2:1634023_at:574:123; Interrogation_Position=755; Antisense; AGCGCTGCATCCAAGAGCTAACCAA
>probe:Drosophila_2:1634023_at:230:331; Interrogation_Position=780; Antisense; GCTGGGCTTCAACGAGATTGTTTCC
>probe:Drosophila_2:1634023_at:657:5; Interrogation_Position=796; Antisense; ATTGTTTCCTTGGAGGTGCTGCAGC
>probe:Drosophila_2:1634023_at:212:305; Interrogation_Position=851; Antisense; CCGTCATCGATCTTGAGTTCCTTAA
>probe:Drosophila_2:1634023_at:678:109; Interrogation_Position=944; Antisense; AGAAGTACCTGACCTCCAGTAATCC

Paste this into a BLAST search page for me
GGTCTCTATCGCATTACTTTCTAAGTAAGAGCACTGAAACCCACTGGCCAAGCGGATCAGGCACGCGACGAGTTCGACATGGTATCGCTGACTTCGTCACTATCACCGGGACGTTTGCAATCTGGGCAATCTGGGCTTTGGTGCGGAACTAAGGCCGATGCGGTCTTCTTGGATCGAAGCTGTCCGGAGGTCGTTTCTGTTTCGTTTTCGCCCTGCATTGAGCAGAGCGCTGCATCCAAGAGCTAACCAAGCTGGGCTTCAACGAGATTGTTTCCATTGTTTCCTTGGAGGTGCTGCAGCCCGTCATCGATCTTGAGTTCCTTAAAGAAGTACCTGACCTCCAGTAATCC

Full Affymetrix probeset data:

Annotations for 1634023_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime