FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634025_at:

>probe:Drosophila_2:1634025_at:86:581; Interrogation_Position=104; Antisense; TGGCCAATGTGACCCAGGTCTCCAT
>probe:Drosophila_2:1634025_at:369:79; Interrogation_Position=119; Antisense; AGGTCTCCATGGACACCGTCAAGTC
>probe:Drosophila_2:1634025_at:441:61; Interrogation_Position=13; Antisense; ATGTGCATGCCGTATTTGAGTAAGC
>probe:Drosophila_2:1634025_at:277:495; Interrogation_Position=136; Antisense; GTCAAGTCCGCCAAGTCAGCGAAGT
>probe:Drosophila_2:1634025_at:609:649; Interrogation_Position=151; Antisense; TCAGCGAAGTCAGCGAAGTCGGCTA
>probe:Drosophila_2:1634025_at:523:1; Interrogation_Position=166; Antisense; AAGTCGGCTAAATCCGGCAAGTCCG
>probe:Drosophila_2:1634025_at:179:235; Interrogation_Position=217; Antisense; AATCCTCCTGAGTCCAGTGTCAGCA
>probe:Drosophila_2:1634025_at:121:505; Interrogation_Position=228; Antisense; GTCCAGTGTCAGCAGCAATGAGGAT
>probe:Drosophila_2:1634025_at:400:455; Interrogation_Position=250; Antisense; GATAATGCGGAGCAACCTCTGGCGA
>probe:Drosophila_2:1634025_at:499:19; Interrogation_Position=26; Antisense; ATTTGAGTAAGCTCTTCGGTGGAGG
>probe:Drosophila_2:1634025_at:633:85; Interrogation_Position=322; Antisense; AGTGCTGCTCCAGCCGACGAGGCGA
>probe:Drosophila_2:1634025_at:249:527; Interrogation_Position=366; Antisense; GGGATACTTTGGCATGAGCAAGAAC
>probe:Drosophila_2:1634025_at:473:373; Interrogation_Position=393; Antisense; GAAGTCCAGCATTGAGTCGCTCTAG
>probe:Drosophila_2:1634025_at:305:501; Interrogation_Position=65; Antisense; GTCGCACCCGCGATGGAGGCGTCAC

Paste this into a BLAST search page for me
TGGCCAATGTGACCCAGGTCTCCATAGGTCTCCATGGACACCGTCAAGTCATGTGCATGCCGTATTTGAGTAAGCGTCAAGTCCGCCAAGTCAGCGAAGTTCAGCGAAGTCAGCGAAGTCGGCTAAAGTCGGCTAAATCCGGCAAGTCCGAATCCTCCTGAGTCCAGTGTCAGCAGTCCAGTGTCAGCAGCAATGAGGATGATAATGCGGAGCAACCTCTGGCGAATTTGAGTAAGCTCTTCGGTGGAGGAGTGCTGCTCCAGCCGACGAGGCGAGGGATACTTTGGCATGAGCAAGAACGAAGTCCAGCATTGAGTCGCTCTAGGTCGCACCCGCGATGGAGGCGTCAC

Full Affymetrix probeset data:

Annotations for 1634025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720