FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634027_at:

>probe:Drosophila_2:1634027_at:256:513; Interrogation_Position=1079; Antisense; GTGAGCATCGCACTTGGCAAGATTT
>probe:Drosophila_2:1634027_at:347:459; Interrogation_Position=1099; Antisense; GATTTGCTGACGCATTTGCAGGTTC
>probe:Drosophila_2:1634027_at:164:443; Interrogation_Position=1126; Antisense; GATGTGAATAGCACCACTCGCTCTA
>probe:Drosophila_2:1634027_at:583:513; Interrogation_Position=1168; Antisense; GTGTATTTTTCCAAGCAGCTACCCG
>probe:Drosophila_2:1634027_at:349:561; Interrogation_Position=1209; Antisense; GGAACAATTCTTTATGCTGCGTCAT
>probe:Drosophila_2:1634027_at:166:561; Interrogation_Position=1248; Antisense; GGAACACTTGGATCCATACTCTGCG
>probe:Drosophila_2:1634027_at:609:29; Interrogation_Position=1263; Antisense; ATACTCTGCGATCAAGTGCCTTCAT
>probe:Drosophila_2:1634027_at:719:333; Interrogation_Position=1308; Antisense; GCTGCATAATCATTTTCCCTTTCAA
>probe:Drosophila_2:1634027_at:265:295; Interrogation_Position=1343; Antisense; CGAGTGATCCGTACCATGTTGGCAT
>probe:Drosophila_2:1634027_at:697:445; Interrogation_Position=1380; Antisense; GATGCAGCACTATCGCTATACGGAA
>probe:Drosophila_2:1634027_at:575:31; Interrogation_Position=1445; Antisense; ATAACATTCGACGATTCCAGCACCA
>probe:Drosophila_2:1634027_at:500:629; Interrogation_Position=932; Antisense; TCCGTTTTCCCAATGAGACCGCAGA
>probe:Drosophila_2:1634027_at:413:103; Interrogation_Position=947; Antisense; AGACCGCAGATCACGAGACATTCCG
>probe:Drosophila_2:1634027_at:160:435; Interrogation_Position=985; Antisense; GAGGTGCTGCTGTACAATGACTGTT

Paste this into a BLAST search page for me
GTGAGCATCGCACTTGGCAAGATTTGATTTGCTGACGCATTTGCAGGTTCGATGTGAATAGCACCACTCGCTCTAGTGTATTTTTCCAAGCAGCTACCCGGGAACAATTCTTTATGCTGCGTCATGGAACACTTGGATCCATACTCTGCGATACTCTGCGATCAAGTGCCTTCATGCTGCATAATCATTTTCCCTTTCAACGAGTGATCCGTACCATGTTGGCATGATGCAGCACTATCGCTATACGGAAATAACATTCGACGATTCCAGCACCATCCGTTTTCCCAATGAGACCGCAGAAGACCGCAGATCACGAGACATTCCGGAGGTGCTGCTGTACAATGACTGTT

Full Affymetrix probeset data:

Annotations for 1634027_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720