FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634029_at:

>probe:Drosophila_2:1634029_at:434:615; Interrogation_Position=1008; Antisense; TGAATCTACGATGAGTCTGGGCACT
>probe:Drosophila_2:1634029_at:260:603; Interrogation_Position=1032; Antisense; TGATATCTACCACTCCAAACTTTTG
>probe:Drosophila_2:1634029_at:449:377; Interrogation_Position=1129; Antisense; GAAGCTGCCTACTATGCGAAGCCAG
>probe:Drosophila_2:1634029_at:81:325; Interrogation_Position=1144; Antisense; GCGAAGCCAGTATTGGGCCTTCCAT
>probe:Drosophila_2:1634029_at:52:433; Interrogation_Position=1305; Antisense; GAGTGCCTTGGCTATTTCCCAAAGA
>probe:Drosophila_2:1634029_at:511:677; Interrogation_Position=1332; Antisense; TAGGGATCAGCCCATTCATCCTTTG
>probe:Drosophila_2:1634029_at:491:269; Interrogation_Position=1348; Antisense; CATCCTTTGGATGCGGCCATTTATT
>probe:Drosophila_2:1634029_at:537:241; Interrogation_Position=1386; Antisense; AATACGCTACAAGGGTGCAGATCAC
>probe:Drosophila_2:1634029_at:679:11; Interrogation_Position=1419; Antisense; ATCTCAGTCCCAGTTAAAGTTGTTC
>probe:Drosophila_2:1634029_at:351:467; Interrogation_Position=1437; Antisense; GTTGTTCGATTACTATTCCCTGGAC
>probe:Drosophila_2:1634029_at:468:647; Interrogation_Position=1466; Antisense; TCATAATGGTCGGATCGCGGCTATC
>probe:Drosophila_2:1634029_at:658:331; Interrogation_Position=1482; Antisense; GCGGCTATCCTTGGTGGTGGCTTTA
>probe:Drosophila_2:1634029_at:687:341; Interrogation_Position=1501; Antisense; GCTTTAGTTTTTCTGGTCCTCTCAA
>probe:Drosophila_2:1634029_at:239:39; Interrogation_Position=1557; Antisense; ATCTGCAAAGTCATTTCTACCTACG

Paste this into a BLAST search page for me
TGAATCTACGATGAGTCTGGGCACTTGATATCTACCACTCCAAACTTTTGGAAGCTGCCTACTATGCGAAGCCAGGCGAAGCCAGTATTGGGCCTTCCATGAGTGCCTTGGCTATTTCCCAAAGATAGGGATCAGCCCATTCATCCTTTGCATCCTTTGGATGCGGCCATTTATTAATACGCTACAAGGGTGCAGATCACATCTCAGTCCCAGTTAAAGTTGTTCGTTGTTCGATTACTATTCCCTGGACTCATAATGGTCGGATCGCGGCTATCGCGGCTATCCTTGGTGGTGGCTTTAGCTTTAGTTTTTCTGGTCCTCTCAAATCTGCAAAGTCATTTCTACCTACG

Full Affymetrix probeset data:

Annotations for 1634029_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720