Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634031_at:

>probe:Drosophila_2:1634031_at:400:543; Interrogation_Position=2999; Antisense; GGATTTTATCCTCGAAGTCAAGTAA
>probe:Drosophila_2:1634031_at:330:253; Interrogation_Position=3044; Antisense; CAAGCAGCAGATCAGATAGTCTCAT
>probe:Drosophila_2:1634031_at:40:701; Interrogation_Position=3138; Antisense; TTTTACTTCATAAGACCAGCTCAAG
>probe:Drosophila_2:1634031_at:498:705; Interrogation_Position=3190; Antisense; TTACGAAACGCGTGGAACTGCGAAT
>probe:Drosophila_2:1634031_at:20:613; Interrogation_Position=3250; Antisense; TGACTTATTGTTTTGGCACTTGCCA
>probe:Drosophila_2:1634031_at:613:565; Interrogation_Position=3264; Antisense; GGCACTTGCCATATAAGCTAAGCGT
>probe:Drosophila_2:1634031_at:501:207; Interrogation_Position=3278; Antisense; AAGCTAAGCGTTTGAATCTTTGAAT
>probe:Drosophila_2:1634031_at:297:367; Interrogation_Position=3314; Antisense; GAATCTCTATCTCGTGTAGGCAGTG
>probe:Drosophila_2:1634031_at:574:683; Interrogation_Position=3369; Antisense; TATGCGATTGTTATCCAGCTAGATT
>probe:Drosophila_2:1634031_at:558:219; Interrogation_Position=3420; Antisense; AAGTGCCTAAGTTTGTATGCTGTAA
>probe:Drosophila_2:1634031_at:682:483; Interrogation_Position=3434; Antisense; GTATGCTGTAATTATAATCCGCTGC
>probe:Drosophila_2:1634031_at:312:235; Interrogation_Position=3449; Antisense; AATCCGCTGCATGTGAATGTAGAAA
>probe:Drosophila_2:1634031_at:696:357; Interrogation_Position=3480; Antisense; GCAAATGTGTCCTTTGTACAGATGA
>probe:Drosophila_2:1634031_at:289:659; Interrogation_Position=3536; Antisense; TAAAATCCATCACTTAGCAAAGCAG

Paste this into a BLAST search page for me
GGATTTTATCCTCGAAGTCAAGTAACAAGCAGCAGATCAGATAGTCTCATTTTTACTTCATAAGACCAGCTCAAGTTACGAAACGCGTGGAACTGCGAATTGACTTATTGTTTTGGCACTTGCCAGGCACTTGCCATATAAGCTAAGCGTAAGCTAAGCGTTTGAATCTTTGAATGAATCTCTATCTCGTGTAGGCAGTGTATGCGATTGTTATCCAGCTAGATTAAGTGCCTAAGTTTGTATGCTGTAAGTATGCTGTAATTATAATCCGCTGCAATCCGCTGCATGTGAATGTAGAAAGCAAATGTGTCCTTTGTACAGATGATAAAATCCATCACTTAGCAAAGCAG

Full Affymetrix probeset data:

Annotations for 1634031_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime