Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634034_at:

>probe:Drosophila_2:1634034_at:699:149; Interrogation_Position=1611; Antisense; ACTTGATCGACGTCAATCAGCGCAC
>probe:Drosophila_2:1634034_at:449:35; Interrogation_Position=1626; Antisense; ATCAGCGCACAGTGTCCGTGGACTA
>probe:Drosophila_2:1634034_at:126:517; Interrogation_Position=1637; Antisense; GTGTCCGTGGACTAACAACTGGCCC
>probe:Drosophila_2:1634034_at:449:287; Interrogation_Position=1661; Antisense; CGGCCACCAACAAGTCCGTAATTGT
>probe:Drosophila_2:1634034_at:665:467; Interrogation_Position=1704; Antisense; GTTAGTCCTAAGTGAACCAATGGTT
>probe:Drosophila_2:1634034_at:602:595; Interrogation_Position=1836; Antisense; TGTGTGGAACTGCTTGTAGCCCCAA
>probe:Drosophila_2:1634034_at:442:205; Interrogation_Position=1913; Antisense; AAGCGCTTAATACGATTGATTTACC
>probe:Drosophila_2:1634034_at:571:163; Interrogation_Position=1942; Antisense; AAATTTGCTCGTGTTCGCTATGCGA
>probe:Drosophila_2:1634034_at:341:289; Interrogation_Position=2012; Antisense; CGTATTAATTCAACGCACATTCCCC
>probe:Drosophila_2:1634034_at:629:135; Interrogation_Position=2048; Antisense; ACGAATCTTGGTTGCGTTGCTGAAG
>probe:Drosophila_2:1634034_at:575:721; Interrogation_Position=2059; Antisense; TTGCGTTGCTGAAGGCACATGCCGA
>probe:Drosophila_2:1634034_at:343:355; Interrogation_Position=2073; Antisense; GCACATGCCGAGCACAAGTGGAGTT
>probe:Drosophila_2:1634034_at:346:519; Interrogation_Position=2098; Antisense; GTGGCGAACTCAAAAATCGTACTGT
>probe:Drosophila_2:1634034_at:50:489; Interrogation_Position=2116; Antisense; GTACTGTGTAGTCTTGAATTTCCTT

Paste this into a BLAST search page for me
ACTTGATCGACGTCAATCAGCGCACATCAGCGCACAGTGTCCGTGGACTAGTGTCCGTGGACTAACAACTGGCCCCGGCCACCAACAAGTCCGTAATTGTGTTAGTCCTAAGTGAACCAATGGTTTGTGTGGAACTGCTTGTAGCCCCAAAAGCGCTTAATACGATTGATTTACCAAATTTGCTCGTGTTCGCTATGCGACGTATTAATTCAACGCACATTCCCCACGAATCTTGGTTGCGTTGCTGAAGTTGCGTTGCTGAAGGCACATGCCGAGCACATGCCGAGCACAAGTGGAGTTGTGGCGAACTCAAAAATCGTACTGTGTACTGTGTAGTCTTGAATTTCCTT

Full Affymetrix probeset data:

Annotations for 1634034_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime