FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634036_at:

>probe:Drosophila_2:1634036_at:205:25; Interrogation_Position=1034; Antisense; ATATGGACGCCATCACAATCCTGGG
>probe:Drosophila_2:1634036_at:402:631; Interrogation_Position=1052; Antisense; TCCTGGGCTTGATCTACTGGCTGAT
>probe:Drosophila_2:1634036_at:710:347; Interrogation_Position=1079; Antisense; GCATGATTGCGTTCGGACCACTGAT
>probe:Drosophila_2:1634036_at:635:259; Interrogation_Position=1097; Antisense; CACTGATGTTCTTCGTCTGCGTTTA
>probe:Drosophila_2:1634036_at:450:307; Interrogation_Position=1126; Antisense; CCAGAGGTTCCGGTGCGATATGTAA
>probe:Drosophila_2:1634036_at:33:289; Interrogation_Position=1214; Antisense; CGTAGTAGATAGATTGCCCAAGCCA
>probe:Drosophila_2:1634036_at:682:439; Interrogation_Position=1255; Antisense; GATGTACACCCGATCGATTTGCAAT
>probe:Drosophila_2:1634036_at:258:713; Interrogation_Position=749; Antisense; TTCTACATCATGTGGCGCGCTTGAA
>probe:Drosophila_2:1634036_at:200:729; Interrogation_Position=787; Antisense; TTGTGGATCGGAGCACCAGTCGGAT
>probe:Drosophila_2:1634036_at:227:57; Interrogation_Position=810; Antisense; ATGAGTCCTGATCCGTGTCTAAAGT
>probe:Drosophila_2:1634036_at:530:497; Interrogation_Position=826; Antisense; GTCTAAAGTGACCTGCAGCTATATA
>probe:Drosophila_2:1634036_at:88:191; Interrogation_Position=874; Antisense; AACATCGGAGCGTTGTCACTGGCAA
>probe:Drosophila_2:1634036_at:268:553; Interrogation_Position=933; Antisense; GGACGAGTCCGGTGTTTAGTGATAC
>probe:Drosophila_2:1634036_at:382:151; Interrogation_Position=986; Antisense; ACATTCATTGTACGTGCTGTCCGAT

Paste this into a BLAST search page for me
ATATGGACGCCATCACAATCCTGGGTCCTGGGCTTGATCTACTGGCTGATGCATGATTGCGTTCGGACCACTGATCACTGATGTTCTTCGTCTGCGTTTACCAGAGGTTCCGGTGCGATATGTAACGTAGTAGATAGATTGCCCAAGCCAGATGTACACCCGATCGATTTGCAATTTCTACATCATGTGGCGCGCTTGAATTGTGGATCGGAGCACCAGTCGGATATGAGTCCTGATCCGTGTCTAAAGTGTCTAAAGTGACCTGCAGCTATATAAACATCGGAGCGTTGTCACTGGCAAGGACGAGTCCGGTGTTTAGTGATACACATTCATTGTACGTGCTGTCCGAT

Full Affymetrix probeset data:

Annotations for 1634036_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720