Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634039_at:

>probe:Drosophila_2:1634039_at:412:177; Interrogation_Position=2622; Antisense; AAACGGACATTGGACCAGCGTCTCA
>probe:Drosophila_2:1634039_at:238:121; Interrogation_Position=2638; Antisense; AGCGTCTCACTACCAGTCAAAGTAT
>probe:Drosophila_2:1634039_at:534:481; Interrogation_Position=2659; Antisense; GTATTGAACAGTACAACCTAGCTAT
>probe:Drosophila_2:1634039_at:180:131; Interrogation_Position=2674; Antisense; ACCTAGCTATAAGGGCCACAGGCTT
>probe:Drosophila_2:1634039_at:671:255; Interrogation_Position=2690; Antisense; CACAGGCTTCAGAACCGGCGGTTGT
>probe:Drosophila_2:1634039_at:575:303; Interrogation_Position=2704; Antisense; CCGGCGGTTGTGTACTTAAAGCAAT
>probe:Drosophila_2:1634039_at:656:657; Interrogation_Position=2728; Antisense; TAAAATAAGTAATCCCCGATATCGG
>probe:Drosophila_2:1634039_at:273:685; Interrogation_Position=2747; Antisense; TATCGGGACAATATCACAGCGCTAT
>probe:Drosophila_2:1634039_at:615:259; Interrogation_Position=2763; Antisense; CAGCGCTATTGTTCCTTAGCATCAG
>probe:Drosophila_2:1634039_at:344:247; Interrogation_Position=2796; Antisense; AATTGGTTGTAACCGCAGAGTACAA
>probe:Drosophila_2:1634039_at:467:525; Interrogation_Position=2827; Antisense; GGGAAACTTTCGCTCAATCTAGGAA
>probe:Drosophila_2:1634039_at:558:513; Interrogation_Position=2903; Antisense; GTGATACTACAGTCTAAGCTTCAAG
>probe:Drosophila_2:1634039_at:451:697; Interrogation_Position=2928; Antisense; TTTACAAGAGAATCGTTGCGCTCGA
>probe:Drosophila_2:1634039_at:405:469; Interrogation_Position=2942; Antisense; GTTGCGCTCGATTGTGCATTAACAA

Paste this into a BLAST search page for me
AAACGGACATTGGACCAGCGTCTCAAGCGTCTCACTACCAGTCAAAGTATGTATTGAACAGTACAACCTAGCTATACCTAGCTATAAGGGCCACAGGCTTCACAGGCTTCAGAACCGGCGGTTGTCCGGCGGTTGTGTACTTAAAGCAATTAAAATAAGTAATCCCCGATATCGGTATCGGGACAATATCACAGCGCTATCAGCGCTATTGTTCCTTAGCATCAGAATTGGTTGTAACCGCAGAGTACAAGGGAAACTTTCGCTCAATCTAGGAAGTGATACTACAGTCTAAGCTTCAAGTTTACAAGAGAATCGTTGCGCTCGAGTTGCGCTCGATTGTGCATTAACAA

Full Affymetrix probeset data:

Annotations for 1634039_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime