FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634041_at:

>probe:Drosophila_2:1634041_at:49:589; Interrogation_Position=363; Antisense; TGGAGCAGTACGACCGCGTCATGAA
>probe:Drosophila_2:1634041_at:340:497; Interrogation_Position=380; Antisense; GTCATGAACACCAACCTGAGGGCAA
>probe:Drosophila_2:1634041_at:666:607; Interrogation_Position=396; Antisense; TGAGGGCAATCTACCACCTTACTAT
>probe:Drosophila_2:1634041_at:414:151; Interrogation_Position=456; Antisense; ACATCGTGAACGTGTCCAGTGTCAA
>probe:Drosophila_2:1634041_at:363:267; Interrogation_Position=472; Antisense; CAGTGTCAATGGGATTCGCTCCTTC
>probe:Drosophila_2:1634041_at:578:327; Interrogation_Position=501; Antisense; GCGTTCTGGCCTACAACATATCCAA
>probe:Drosophila_2:1634041_at:244:65; Interrogation_Position=527; Antisense; ATGGGAGTGGATCAGTTCACCCGCT
>probe:Drosophila_2:1634041_at:496:91; Interrogation_Position=540; Antisense; AGTTCACCCGCTGTGTGGCGTTGGA
>probe:Drosophila_2:1634041_at:204:573; Interrogation_Position=605; Antisense; GGCGTGACGGTCACCAATCTGCATG
>probe:Drosophila_2:1634041_at:113:49; Interrogation_Position=690; Antisense; ATGCCTTGGGTCGTCCTGGAGATGT
>probe:Drosophila_2:1634041_at:385:117; Interrogation_Position=761; Antisense; AGCTTCAGCACTGGAGTCAGCCTGC
>probe:Drosophila_2:1634041_at:235:259; Interrogation_Position=816; Antisense; CACGCTAATCCCACAGGACATGGAA
>probe:Drosophila_2:1634041_at:475:189; Interrogation_Position=839; Antisense; AACTTTTAGTTTCCCCTGCATGGAT
>probe:Drosophila_2:1634041_at:239:543; Interrogation_Position=860; Antisense; GGATTCTTCCATGAGTAAATGCATT

Paste this into a BLAST search page for me
TGGAGCAGTACGACCGCGTCATGAAGTCATGAACACCAACCTGAGGGCAATGAGGGCAATCTACCACCTTACTATACATCGTGAACGTGTCCAGTGTCAACAGTGTCAATGGGATTCGCTCCTTCGCGTTCTGGCCTACAACATATCCAAATGGGAGTGGATCAGTTCACCCGCTAGTTCACCCGCTGTGTGGCGTTGGAGGCGTGACGGTCACCAATCTGCATGATGCCTTGGGTCGTCCTGGAGATGTAGCTTCAGCACTGGAGTCAGCCTGCCACGCTAATCCCACAGGACATGGAAAACTTTTAGTTTCCCCTGCATGGATGGATTCTTCCATGAGTAAATGCATT

Full Affymetrix probeset data:

Annotations for 1634041_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720