Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634043_at:

>probe:Drosophila_2:1634043_at:717:707; Interrogation_Position=1063; Antisense; TTAAAGTTGCTACGTGCCCTGGCTG
>probe:Drosophila_2:1634043_at:21:289; Interrogation_Position=1081; Antisense; CTGGCTGGCCAAGACTCCGTGAAGT
>probe:Drosophila_2:1634043_at:642:489; Interrogation_Position=1114; Antisense; GTACAGCAGGGCGTGGCTCCTATAA
>probe:Drosophila_2:1634043_at:401:721; Interrogation_Position=1147; Antisense; TTGCTAGAGACGCACCAGTCCAATG
>probe:Drosophila_2:1634043_at:549:229; Interrogation_Position=1168; Antisense; AATGAAAACATCGTTGCCGCCGCTT
>probe:Drosophila_2:1634043_at:520:691; Interrogation_Position=1191; Antisense; TTTGGCCTGCGTGACTACTCTGACA
>probe:Drosophila_2:1634043_at:485:433; Interrogation_Position=1220; Antisense; GAGTGCAGGAACACAGTGCCGCCTT
>probe:Drosophila_2:1634043_at:719:217; Interrogation_Position=1265; Antisense; AAGTAATCGTGGAGGCTCTTCGCGC
>probe:Drosophila_2:1634043_at:665:417; Interrogation_Position=1322; Antisense; GAGCGTGGGCCATCCGCAATATGGT
>probe:Drosophila_2:1634043_at:130:249; Interrogation_Position=1338; Antisense; CAATATGGTGTCACGGTCGCGGAAC
>probe:Drosophila_2:1634043_at:111:83; Interrogation_Position=1364; Antisense; AGTGTGAAACCTGGATCTCCTTCGG
>probe:Drosophila_2:1634043_at:421:275; Interrogation_Position=1383; Antisense; CTTCGGCGTTGAGGATCTACTAAAT
>probe:Drosophila_2:1634043_at:181:181; Interrogation_Position=1515; Antisense; AAAAATTGCCGCCTAATCGCACACA
>probe:Drosophila_2:1634043_at:96:237; Interrogation_Position=1529; Antisense; AATCGCACACACATATGCCTTTTGT

Paste this into a BLAST search page for me
TTAAAGTTGCTACGTGCCCTGGCTGCTGGCTGGCCAAGACTCCGTGAAGTGTACAGCAGGGCGTGGCTCCTATAATTGCTAGAGACGCACCAGTCCAATGAATGAAAACATCGTTGCCGCCGCTTTTTGGCCTGCGTGACTACTCTGACAGAGTGCAGGAACACAGTGCCGCCTTAAGTAATCGTGGAGGCTCTTCGCGCGAGCGTGGGCCATCCGCAATATGGTCAATATGGTGTCACGGTCGCGGAACAGTGTGAAACCTGGATCTCCTTCGGCTTCGGCGTTGAGGATCTACTAAATAAAAATTGCCGCCTAATCGCACACAAATCGCACACACATATGCCTTTTGT

Full Affymetrix probeset data:

Annotations for 1634043_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime