FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634045_at:

>probe:Drosophila_2:1634045_at:486:433; Interrogation_Position=1048; Antisense; GAGTGGACAATCACATTCTCCCATT
>probe:Drosophila_2:1634045_at:82:273; Interrogation_Position=1069; Antisense; CATTCCAGCGGCCTTGCCGTAAAAA
>probe:Drosophila_2:1634045_at:218:151; Interrogation_Position=612; Antisense; ACATTCCAGTTATTGGTGGCCATGC
>probe:Drosophila_2:1634045_at:603:529; Interrogation_Position=638; Antisense; GGGATTACAATTCTACCGCTCATTT
>probe:Drosophila_2:1634045_at:66:339; Interrogation_Position=655; Antisense; GCTCATTTCGCAGTGTCAGCCGATA
>probe:Drosophila_2:1634045_at:3:367; Interrogation_Position=706; Antisense; GAATCTAACTCATCGCATTCAGGAG
>probe:Drosophila_2:1634045_at:439:685; Interrogation_Position=780; Antisense; TATCGATGGCTTATGCTGGCGCAAC
>probe:Drosophila_2:1634045_at:172:53; Interrogation_Position=792; Antisense; ATGCTGGCGCAACTTTCGTGAACTC
>probe:Drosophila_2:1634045_at:312:511; Interrogation_Position=809; Antisense; GTGAACTCCCTGCTGCGTGGAATTG
>probe:Drosophila_2:1634045_at:482:547; Interrogation_Position=841; Antisense; GGATGGTCTAATCGAGTGCGCTTTT
>probe:Drosophila_2:1634045_at:580:301; Interrogation_Position=889; Antisense; CCCATTCTTTGCTAGTCCATTGGAA
>probe:Drosophila_2:1634045_at:295:685; Interrogation_Position=928; Antisense; TATCAAGCGCTATATACCACTTCCC
>probe:Drosophila_2:1634045_at:446:149; Interrogation_Position=946; Antisense; ACTTCCCCAGATGAGTGACTACGAA
>probe:Drosophila_2:1634045_at:521:207; Interrogation_Position=986; Antisense; AAGCTACTACCTATTCTACGACAGA

Paste this into a BLAST search page for me
GAGTGGACAATCACATTCTCCCATTCATTCCAGCGGCCTTGCCGTAAAAAACATTCCAGTTATTGGTGGCCATGCGGGATTACAATTCTACCGCTCATTTGCTCATTTCGCAGTGTCAGCCGATAGAATCTAACTCATCGCATTCAGGAGTATCGATGGCTTATGCTGGCGCAACATGCTGGCGCAACTTTCGTGAACTCGTGAACTCCCTGCTGCGTGGAATTGGGATGGTCTAATCGAGTGCGCTTTTCCCATTCTTTGCTAGTCCATTGGAATATCAAGCGCTATATACCACTTCCCACTTCCCCAGATGAGTGACTACGAAAAGCTACTACCTATTCTACGACAGA

Full Affymetrix probeset data:

Annotations for 1634045_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720