Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634047_a_at:

>probe:Drosophila_2:1634047_a_at:609:341; Interrogation_Position=128; Antisense; GCATAAAGTTTTACCCATCGCTGGA
>probe:Drosophila_2:1634047_a_at:266:45; Interrogation_Position=144; Antisense; ATCGCTGGACATGGATATCCTGGAC
>probe:Drosophila_2:1634047_a_at:493:585; Interrogation_Position=164; Antisense; TGGACATCGATGAGGCACTAAAGGA
>probe:Drosophila_2:1634047_a_at:118:463; Interrogation_Position=190; Antisense; GATTCATATATATTTCTGGCGGATA
>probe:Drosophila_2:1634047_a_at:369:635; Interrogation_Position=204; Antisense; TCTGGCGGATAAGACCCACGACGAT
>probe:Drosophila_2:1634047_a_at:193:409; Interrogation_Position=223; Antisense; GACGATGTCTCCAACATATTGCAGC
>probe:Drosophila_2:1634047_a_at:70:273; Interrogation_Position=237; Antisense; CATATTGCAGCAGTGGAAGACGAAC
>probe:Drosophila_2:1634047_a_at:634:375; Interrogation_Position=252; Antisense; GAAGACGAACAATCAGCCGCCGTTG
>probe:Drosophila_2:1634047_a_at:527:5; Interrogation_Position=282; Antisense; ATTGCACTTGCAGTACAACAACGAG
>probe:Drosophila_2:1634047_a_at:658:689; Interrogation_Position=41; Antisense; TATTGGCCAAACAGACAAGCGAGCG
>probe:Drosophila_2:1634047_a_at:65:251; Interrogation_Position=56; Antisense; CAAGCGAGCGAAGGCCTTTTTGTTG
>probe:Drosophila_2:1634047_a_at:84:315; Interrogation_Position=69; Antisense; GCCTTTTTGTTGTCGTTTCTGGCAA
>probe:Drosophila_2:1634047_a_at:97:479; Interrogation_Position=83; Antisense; GTTTCTGGCAATGATTTAGGTCTTC
>probe:Drosophila_2:1634047_a_at:67:459; Interrogation_Position=95; Antisense; GATTTAGGTCTTCATCAAGTGTTAT

Paste this into a BLAST search page for me
GCATAAAGTTTTACCCATCGCTGGAATCGCTGGACATGGATATCCTGGACTGGACATCGATGAGGCACTAAAGGAGATTCATATATATTTCTGGCGGATATCTGGCGGATAAGACCCACGACGATGACGATGTCTCCAACATATTGCAGCCATATTGCAGCAGTGGAAGACGAACGAAGACGAACAATCAGCCGCCGTTGATTGCACTTGCAGTACAACAACGAGTATTGGCCAAACAGACAAGCGAGCGCAAGCGAGCGAAGGCCTTTTTGTTGGCCTTTTTGTTGTCGTTTCTGGCAAGTTTCTGGCAATGATTTAGGTCTTCGATTTAGGTCTTCATCAAGTGTTAT

Full Affymetrix probeset data:

Annotations for 1634047_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime