FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634050_at:

>probe:Drosophila_2:1634050_at:214:281; Interrogation_Position=1383; Antisense; CTCATCGCTGTATGCTCCAGGTAAA
>probe:Drosophila_2:1634050_at:273:185; Interrogation_Position=1405; Antisense; AAAATGGGCTTCATGCCCACGAGAC
>probe:Drosophila_2:1634050_at:38:721; Interrogation_Position=1453; Antisense; TTCCGCAGCGAGGTCATCGAACAGG
>probe:Drosophila_2:1634050_at:293:353; Interrogation_Position=1487; Antisense; GCACCGTTCCGGAGGATCTGCAAAA
>probe:Drosophila_2:1634050_at:1:453; Interrogation_Position=1525; Antisense; GATCGGCTAATGACCTCGTTGCGAG
>probe:Drosophila_2:1634050_at:481:565; Interrogation_Position=1575; Antisense; GGAATTCGGCACTACTCTATACGTT
>probe:Drosophila_2:1634050_at:101:645; Interrogation_Position=1590; Antisense; TCTATACGTTTCATCATCGCGCGAG
>probe:Drosophila_2:1634050_at:227:45; Interrogation_Position=1605; Antisense; ATCGCGCGAGGACGATCTCATTGAG
>probe:Drosophila_2:1634050_at:530:309; Interrogation_Position=1664; Antisense; CCACCAGCTCCATGTCTGTGAAGAA
>probe:Drosophila_2:1634050_at:433:309; Interrogation_Position=1691; Antisense; CCAGCAGTGAGGGTTCAGTGGCTCC
>probe:Drosophila_2:1634050_at:631:479; Interrogation_Position=1738; Antisense; GTTTCCGCATCCTCGAAGGACATCA
>probe:Drosophila_2:1634050_at:225:75; Interrogation_Position=1754; Antisense; AGGACATCAAGGGTGCTCCCAGCAT
>probe:Drosophila_2:1634050_at:173:407; Interrogation_Position=1797; Antisense; GACGGCCACATCCAAAATGACGGGT
>probe:Drosophila_2:1634050_at:576:555; Interrogation_Position=1863; Antisense; GGACTTCGATGTGCAGTTCGTCTAC

Paste this into a BLAST search page for me
CTCATCGCTGTATGCTCCAGGTAAAAAAATGGGCTTCATGCCCACGAGACTTCCGCAGCGAGGTCATCGAACAGGGCACCGTTCCGGAGGATCTGCAAAAGATCGGCTAATGACCTCGTTGCGAGGGAATTCGGCACTACTCTATACGTTTCTATACGTTTCATCATCGCGCGAGATCGCGCGAGGACGATCTCATTGAGCCACCAGCTCCATGTCTGTGAAGAACCAGCAGTGAGGGTTCAGTGGCTCCGTTTCCGCATCCTCGAAGGACATCAAGGACATCAAGGGTGCTCCCAGCATGACGGCCACATCCAAAATGACGGGTGGACTTCGATGTGCAGTTCGTCTAC

Full Affymetrix probeset data:

Annotations for 1634050_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720