FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634053_at:

>probe:Drosophila_2:1634053_at:329:611; Interrogation_Position=1303; Antisense; TGACTAGTTCGAGCGAGGCCTTCTC
>probe:Drosophila_2:1634053_at:256:285; Interrogation_Position=1328; Antisense; CTGGACCTCAATGGGCATCCTGATG
>probe:Drosophila_2:1634053_at:543:47; Interrogation_Position=1344; Antisense; ATCCTGATGGCCTGCGCCTGTGCAT
>probe:Drosophila_2:1634053_at:40:623; Interrogation_Position=1375; Antisense; TGCCCGGTCTACTCAAGAACAAGTT
>probe:Drosophila_2:1634053_at:357:657; Interrogation_Position=1419; Antisense; TAAGCTGGCCGGAGGATGTGTCCAA
>probe:Drosophila_2:1634053_at:689:687; Interrogation_Position=1456; Antisense; TATATGTATGCTATTCCCCAAACCG
>probe:Drosophila_2:1634053_at:432:491; Interrogation_Position=1511; Antisense; GTAATTTATACACTACGCCAGAAAC
>probe:Drosophila_2:1634053_at:1:701; Interrogation_Position=1578; Antisense; TTTTCGGAATGCCACTTTGGGTCTC
>probe:Drosophila_2:1634053_at:639:723; Interrogation_Position=1594; Antisense; TTGGGTCTCGATCCACTATGTTTAA
>probe:Drosophila_2:1634053_at:215:599; Interrogation_Position=1665; Antisense; TGTTTTCTGAACTTGTTCTTACCAA
>probe:Drosophila_2:1634053_at:624:345; Interrogation_Position=1699; Antisense; GCATCATATATTTCCATCAATCGTT
>probe:Drosophila_2:1634053_at:446:175; Interrogation_Position=1789; Antisense; AAACGAGTTAGCAGAAATCCATTGA
>probe:Drosophila_2:1634053_at:509:235; Interrogation_Position=1804; Antisense; AATCCATTGAATATTACGCAGCGTA
>probe:Drosophila_2:1634053_at:90:485; Interrogation_Position=1855; Antisense; GTATGTGTCTGCAAGTAAACGTTAA

Paste this into a BLAST search page for me
TGACTAGTTCGAGCGAGGCCTTCTCCTGGACCTCAATGGGCATCCTGATGATCCTGATGGCCTGCGCCTGTGCATTGCCCGGTCTACTCAAGAACAAGTTTAAGCTGGCCGGAGGATGTGTCCAATATATGTATGCTATTCCCCAAACCGGTAATTTATACACTACGCCAGAAACTTTTCGGAATGCCACTTTGGGTCTCTTGGGTCTCGATCCACTATGTTTAATGTTTTCTGAACTTGTTCTTACCAAGCATCATATATTTCCATCAATCGTTAAACGAGTTAGCAGAAATCCATTGAAATCCATTGAATATTACGCAGCGTAGTATGTGTCTGCAAGTAAACGTTAA

Full Affymetrix probeset data:

Annotations for 1634053_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720