FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634054_at:

>probe:Drosophila_2:1634054_at:235:631; Interrogation_Position=4247; Antisense; TCCTCCGTCGGATCCAGTTAGAGAA
>probe:Drosophila_2:1634054_at:350:385; Interrogation_Position=4269; Antisense; GAACTTCAGAACATGGCTCGCAACG
>probe:Drosophila_2:1634054_at:484:607; Interrogation_Position=4307; Antisense; TGAGGATCCACCATTCAACTTCAAG
>probe:Drosophila_2:1634054_at:359:191; Interrogation_Position=4323; Antisense; AACTTCAAGGCTATGCTGCGCAAGA
>probe:Drosophila_2:1634054_at:324:303; Interrogation_Position=4366; Antisense; CCGAGACCAACACCTATGACTTTAA
>probe:Drosophila_2:1634054_at:503:55; Interrogation_Position=4381; Antisense; ATGACTTTAACAATCGCCGCGGATC
>probe:Drosophila_2:1634054_at:77:399; Interrogation_Position=4451; Antisense; GACAGGTCGCCGGTACCAAGACGAT
>probe:Drosophila_2:1634054_at:185:101; Interrogation_Position=4534; Antisense; AGAGGGCTCCGACCTTGAGACAATC
>probe:Drosophila_2:1634054_at:694:121; Interrogation_Position=4566; Antisense; AGCGTGGGTCGCAGCTTCGAAGATA
>probe:Drosophila_2:1634054_at:4:677; Interrogation_Position=4589; Antisense; TAGCAATGCTAGATCCTTCGAGGAG
>probe:Drosophila_2:1634054_at:113:551; Interrogation_Position=4634; Antisense; GGAGATTGCACCTGGAATCACTCTT
>probe:Drosophila_2:1634054_at:679:365; Interrogation_Position=4648; Antisense; GAATCACTCTTTCAGGCTATGCCGT
>probe:Drosophila_2:1634054_at:17:571; Interrogation_Position=4662; Antisense; GGCTATGCCGTCGATATCTAAAACT
>probe:Drosophila_2:1634054_at:68:375; Interrogation_Position=4778; Antisense; GAAGTTTTCTTCATCACTTTCTCAA

Paste this into a BLAST search page for me
TCCTCCGTCGGATCCAGTTAGAGAAGAACTTCAGAACATGGCTCGCAACGTGAGGATCCACCATTCAACTTCAAGAACTTCAAGGCTATGCTGCGCAAGACCGAGACCAACACCTATGACTTTAAATGACTTTAACAATCGCCGCGGATCGACAGGTCGCCGGTACCAAGACGATAGAGGGCTCCGACCTTGAGACAATCAGCGTGGGTCGCAGCTTCGAAGATATAGCAATGCTAGATCCTTCGAGGAGGGAGATTGCACCTGGAATCACTCTTGAATCACTCTTTCAGGCTATGCCGTGGCTATGCCGTCGATATCTAAAACTGAAGTTTTCTTCATCACTTTCTCAA

Full Affymetrix probeset data:

Annotations for 1634054_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720