FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634055_at:

>probe:Drosophila_2:1634055_at:567:79; Interrogation_Position=1043; Antisense; AGGGACTCTACTATACGGCTACAAC
>probe:Drosophila_2:1634055_at:215:277; Interrogation_Position=1061; Antisense; CTACAACGGGTGTGGTATCTGGCAC
>probe:Drosophila_2:1634055_at:238:683; Interrogation_Position=1076; Antisense; TATCTGGCACCTAGCTCTCTAAAAA
>probe:Drosophila_2:1634055_at:152:229; Interrogation_Position=1111; Antisense; AATGGTCGCACAACCAGAGCACTGA
>probe:Drosophila_2:1634055_at:587:63; Interrogation_Position=1157; Antisense; ATGTGTCCTATACGAATCCATTCAG
>probe:Drosophila_2:1634055_at:671:223; Interrogation_Position=700; Antisense; AAGGATGCCGCCCAAATTGTCACCG
>probe:Drosophila_2:1634055_at:544:5; Interrogation_Position=715; Antisense; ATTGTCACCGAGTTCGCCGAAAAAG
>probe:Drosophila_2:1634055_at:657:251; Interrogation_Position=789; Antisense; CAACGAGTTCTCTACGGGCATAAAG
>probe:Drosophila_2:1634055_at:681:471; Interrogation_Position=813; Antisense; GTTCGGACAGACAGCTGATCCCAGT
>probe:Drosophila_2:1634055_at:435:435; Interrogation_Position=862; Antisense; GAGGGTCCACTTTTCGTATACGAGC
>probe:Drosophila_2:1634055_at:285:483; Interrogation_Position=877; Antisense; GTATACGAGCCACTTGTTCCTTTCA
>probe:Drosophila_2:1634055_at:184:469; Interrogation_Position=892; Antisense; GTTCCTTTCAGTGAGGGACCTGCCA
>probe:Drosophila_2:1634055_at:587:687; Interrogation_Position=949; Antisense; TATATTGCCCACATACGAGCTGAAA
>probe:Drosophila_2:1634055_at:468:13; Interrogation_Position=996; Antisense; ATTCACATCCGCTCTGGCTTGTGAA

Paste this into a BLAST search page for me
AGGGACTCTACTATACGGCTACAACCTACAACGGGTGTGGTATCTGGCACTATCTGGCACCTAGCTCTCTAAAAAAATGGTCGCACAACCAGAGCACTGAATGTGTCCTATACGAATCCATTCAGAAGGATGCCGCCCAAATTGTCACCGATTGTCACCGAGTTCGCCGAAAAAGCAACGAGTTCTCTACGGGCATAAAGGTTCGGACAGACAGCTGATCCCAGTGAGGGTCCACTTTTCGTATACGAGCGTATACGAGCCACTTGTTCCTTTCAGTTCCTTTCAGTGAGGGACCTGCCATATATTGCCCACATACGAGCTGAAAATTCACATCCGCTCTGGCTTGTGAA

Full Affymetrix probeset data:

Annotations for 1634055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720