Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634056_at:

>probe:Drosophila_2:1634056_at:382:715; Interrogation_Position=1494; Antisense; TTCGATAGCGTCAAGGTCTTCTCCG
>probe:Drosophila_2:1634056_at:368:159; Interrogation_Position=1522; Antisense; ACAAGTCCTTCCTGGAGAACGTGAA
>probe:Drosophila_2:1634056_at:425:511; Interrogation_Position=1542; Antisense; GTGAACGACCTAAGCATCCTCAAGA
>probe:Drosophila_2:1634056_at:480:375; Interrogation_Position=1565; Antisense; GAAGAAGCCCATGCATGAGTCAGAT
>probe:Drosophila_2:1634056_at:544:227; Interrogation_Position=1655; Antisense; AATGGGAGGCGCTCCGCCCAAATGA
>probe:Drosophila_2:1634056_at:140:381; Interrogation_Position=1701; Antisense; GAACCGCCAAGGCAACCTGATGATT
>probe:Drosophila_2:1634056_at:669:653; Interrogation_Position=1765; Antisense; TAATTTTGAGCTGAGTGCCGGGAAA
>probe:Drosophila_2:1634056_at:87:217; Interrogation_Position=1788; Antisense; AAGTTGGGACGCATCTTTTCGCCCA
>probe:Drosophila_2:1634056_at:79:247; Interrogation_Position=1812; Antisense; AATTCATTTTCACCAGGCATTCGAC
>probe:Drosophila_2:1634056_at:115:75; Interrogation_Position=1853; Antisense; AGGACATCCTTAACATCTTCCATGG
>probe:Drosophila_2:1634056_at:573:189; Interrogation_Position=1900; Antisense; AACATTCAATGCCAAGCCCCGATGG
>probe:Drosophila_2:1634056_at:632:521; Interrogation_Position=1957; Antisense; GGGCCGTGTAATCAAGCCAGAACAA
>probe:Drosophila_2:1634056_at:280:107; Interrogation_Position=2018; Antisense; AGAACTTGGATTCGGCTCTACAGCC
>probe:Drosophila_2:1634056_at:677:337; Interrogation_Position=2032; Antisense; GCTCTACAGCCAGGATCACATCGAT

Paste this into a BLAST search page for me
TTCGATAGCGTCAAGGTCTTCTCCGACAAGTCCTTCCTGGAGAACGTGAAGTGAACGACCTAAGCATCCTCAAGAGAAGAAGCCCATGCATGAGTCAGATAATGGGAGGCGCTCCGCCCAAATGAGAACCGCCAAGGCAACCTGATGATTTAATTTTGAGCTGAGTGCCGGGAAAAAGTTGGGACGCATCTTTTCGCCCAAATTCATTTTCACCAGGCATTCGACAGGACATCCTTAACATCTTCCATGGAACATTCAATGCCAAGCCCCGATGGGGGCCGTGTAATCAAGCCAGAACAAAGAACTTGGATTCGGCTCTACAGCCGCTCTACAGCCAGGATCACATCGAT

Full Affymetrix probeset data:

Annotations for 1634056_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime