FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634057_at:

>probe:Drosophila_2:1634057_at:524:695; Interrogation_Position=561; Antisense; TTTCGGCCTATTGCGACAATTTCGA
>probe:Drosophila_2:1634057_at:268:365; Interrogation_Position=593; Antisense; GAATCCTGGGATTCGGTAAGACCAT
>probe:Drosophila_2:1634057_at:666:491; Interrogation_Position=608; Antisense; GTAAGACCATTTGGCACTGGAACGT
>probe:Drosophila_2:1634057_at:416:273; Interrogation_Position=653; Antisense; CATTCATCGGTGTCATTGGAGAGGC
>probe:Drosophila_2:1634057_at:277:565; Interrogation_Position=675; Antisense; GGCAAAGGCCAGCTTCAATACTGTG
>probe:Drosophila_2:1634057_at:634:241; Interrogation_Position=691; Antisense; AATACTGTGGAGTCCCAACGACGCA
>probe:Drosophila_2:1634057_at:663:133; Interrogation_Position=711; Antisense; ACGCATCTACTTCATTTCCATTCTG
>probe:Drosophila_2:1634057_at:401:563; Interrogation_Position=792; Antisense; GGAAGGCACTTTGTACACCTACAGT
>probe:Drosophila_2:1634057_at:701:205; Interrogation_Position=838; Antisense; AAGCGCACTCCTCGAATGTTTATAA
>probe:Drosophila_2:1634057_at:238:563; Interrogation_Position=873; Antisense; GGAAGGTCCGCAGTTTCTAATTGAT
>probe:Drosophila_2:1634057_at:163:375; Interrogation_Position=925; Antisense; GAAGATCCTCACAATTCGTTCGACT
>probe:Drosophila_2:1634057_at:201:247; Interrogation_Position=937; Antisense; AATTCGTTCGACTTGCCACCAGGAA
>probe:Drosophila_2:1634057_at:159:73; Interrogation_Position=957; Antisense; AGGAACGGACTTTGCCATTCGAGTT
>probe:Drosophila_2:1634057_at:403:273; Interrogation_Position=972; Antisense; CATTCGAGTTGAGACCAGGTGCTTT

Paste this into a BLAST search page for me
TTTCGGCCTATTGCGACAATTTCGAGAATCCTGGGATTCGGTAAGACCATGTAAGACCATTTGGCACTGGAACGTCATTCATCGGTGTCATTGGAGAGGCGGCAAAGGCCAGCTTCAATACTGTGAATACTGTGGAGTCCCAACGACGCAACGCATCTACTTCATTTCCATTCTGGGAAGGCACTTTGTACACCTACAGTAAGCGCACTCCTCGAATGTTTATAAGGAAGGTCCGCAGTTTCTAATTGATGAAGATCCTCACAATTCGTTCGACTAATTCGTTCGACTTGCCACCAGGAAAGGAACGGACTTTGCCATTCGAGTTCATTCGAGTTGAGACCAGGTGCTTT

Full Affymetrix probeset data:

Annotations for 1634057_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720