FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634059_at:

>probe:Drosophila_2:1634059_at:527:115; Interrogation_Position=120; Antisense; AGCATCGGCGGCTGCGAATGGTTCC
>probe:Drosophila_2:1634059_at:711:695; Interrogation_Position=256; Antisense; TTATGCGGTTGCCAAAAGGCGCCCA
>probe:Drosophila_2:1634059_at:536:227; Interrogation_Position=271; Antisense; AAGGCGCCCAAGTCACACTGCATAT
>probe:Drosophila_2:1634059_at:411:345; Interrogation_Position=290; Antisense; GCATATCAGCAACAGGCGTACTTTT
>probe:Drosophila_2:1634059_at:625:489; Interrogation_Position=307; Antisense; GTACTTTTGTTGGTGCTGCTCTACA
>probe:Drosophila_2:1634059_at:699:155; Interrogation_Position=329; Antisense; ACACGGCCATGGGTTCCATTGTATT
>probe:Drosophila_2:1634059_at:381:5; Interrogation_Position=346; Antisense; ATTGTATTCGTGACCCTCGAGGGCG
>probe:Drosophila_2:1634059_at:265:675; Interrogation_Position=392; Antisense; TAGAAACCGCTGTGGCCGCTTCTAA
>probe:Drosophila_2:1634059_at:314:225; Interrogation_Position=511; Antisense; AAGGAGAATTGGACGCGACTCGCCG
>probe:Drosophila_2:1634059_at:1:155; Interrogation_Position=537; Antisense; ACAGGAGGTGCAGCTATTTCAGGAC
>probe:Drosophila_2:1634059_at:686:17; Interrogation_Position=552; Antisense; ATTTCAGGACACTTTGCTGCGGGCG
>probe:Drosophila_2:1634059_at:612:507; Interrogation_Position=577; Antisense; GTGCGACAGTCGAAGGTTTATCCCC
>probe:Drosophila_2:1634059_at:201:565; Interrogation_Position=607; Antisense; GGAATCCAGTTGAATGCGCCCACAC
>probe:Drosophila_2:1634059_at:261:713; Interrogation_Position=656; Antisense; TTCTCTACTCCCTGACATTAATTAC

Paste this into a BLAST search page for me
AGCATCGGCGGCTGCGAATGGTTCCTTATGCGGTTGCCAAAAGGCGCCCAAAGGCGCCCAAGTCACACTGCATATGCATATCAGCAACAGGCGTACTTTTGTACTTTTGTTGGTGCTGCTCTACAACACGGCCATGGGTTCCATTGTATTATTGTATTCGTGACCCTCGAGGGCGTAGAAACCGCTGTGGCCGCTTCTAAAAGGAGAATTGGACGCGACTCGCCGACAGGAGGTGCAGCTATTTCAGGACATTTCAGGACACTTTGCTGCGGGCGGTGCGACAGTCGAAGGTTTATCCCCGGAATCCAGTTGAATGCGCCCACACTTCTCTACTCCCTGACATTAATTAC

Full Affymetrix probeset data:

Annotations for 1634059_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720