FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634062_at:

>probe:Drosophila_2:1634062_at:709:717; Interrogation_Position=1021; Antisense; TTCCCAACTTTCAATCAGCAGCAGT
>probe:Drosophila_2:1634062_at:183:315; Interrogation_Position=465; Antisense; GCCGAACTATGACTACGACTATGAC
>probe:Drosophila_2:1634062_at:588:403; Interrogation_Position=481; Antisense; GACTATGACTATGATGCGCAGCCAG
>probe:Drosophila_2:1634062_at:295:593; Interrogation_Position=632; Antisense; TGGGCGACCGCCTTATCTATCAGTA
>probe:Drosophila_2:1634062_at:723:89; Interrogation_Position=653; Antisense; AGTACGCACAACCTACTGATACCTT
>probe:Drosophila_2:1634062_at:177:605; Interrogation_Position=669; Antisense; TGATACCTTCTTTAGGTCGCGAGCC
>probe:Drosophila_2:1634062_at:397:573; Interrogation_Position=714; Antisense; GGCTGACCCAGACAGCGGAGACTTA
>probe:Drosophila_2:1634062_at:383:385; Interrogation_Position=731; Antisense; GAGACTTAGTTGACTCCCAGGACCC
>probe:Drosophila_2:1634062_at:186:547; Interrogation_Position=774; Antisense; GGATGCGGCTGCATTTCCTGTCACT
>probe:Drosophila_2:1634062_at:135:721; Interrogation_Position=788; Antisense; TTCCTGTCACTGCAGATGGGCCTGA
>probe:Drosophila_2:1634062_at:682:219; Interrogation_Position=837; Antisense; AAGTGCTTCGCGATTTTTGGTCAAC
>probe:Drosophila_2:1634062_at:180:103; Interrogation_Position=866; Antisense; AGAGCGATGACGACTTTGGGCAGCC
>probe:Drosophila_2:1634062_at:493:467; Interrogation_Position=944; Antisense; GTTCAGCGGGTGCTTCTGGTATTCC
>probe:Drosophila_2:1634062_at:101:635; Interrogation_Position=998; Antisense; TCGAGCTTGGCAACACGAATCGCTT

Paste this into a BLAST search page for me
TTCCCAACTTTCAATCAGCAGCAGTGCCGAACTATGACTACGACTATGACGACTATGACTATGATGCGCAGCCAGTGGGCGACCGCCTTATCTATCAGTAAGTACGCACAACCTACTGATACCTTTGATACCTTCTTTAGGTCGCGAGCCGGCTGACCCAGACAGCGGAGACTTAGAGACTTAGTTGACTCCCAGGACCCGGATGCGGCTGCATTTCCTGTCACTTTCCTGTCACTGCAGATGGGCCTGAAAGTGCTTCGCGATTTTTGGTCAACAGAGCGATGACGACTTTGGGCAGCCGTTCAGCGGGTGCTTCTGGTATTCCTCGAGCTTGGCAACACGAATCGCTT

Full Affymetrix probeset data:

Annotations for 1634062_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720