FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634064_at:

>probe:Drosophila_2:1634064_at:487:473; Interrogation_Position=14; Antisense; GTTAGTCCGTTAGTCACATTCAAAG
>probe:Drosophila_2:1634064_at:660:199; Interrogation_Position=166; Antisense; AACGCACTATAGCTTTTGCTCCGAT
>probe:Drosophila_2:1634064_at:466:693; Interrogation_Position=180; Antisense; TTTGCTCCGATAATGTGGCGCCCAA
>probe:Drosophila_2:1634064_at:23:33; Interrogation_Position=204; Antisense; ATCAGGTCCTTCAGTGTCCGGATAA
>probe:Drosophila_2:1634064_at:115:413; Interrogation_Position=242; Antisense; GACCTGGCAATCATCTGCATGGACA
>probe:Drosophila_2:1634064_at:237:85; Interrogation_Position=269; Antisense; AGTGTAGTGGATAGCTCCTGCTCAG
>probe:Drosophila_2:1634064_at:589:389; Interrogation_Position=327; Antisense; GAAACAGCATGTTCGTCTGCACCAG
>probe:Drosophila_2:1634064_at:359:127; Interrogation_Position=356; Antisense; ACCACCTTCCAGATGTGCGATGGCA
>probe:Drosophila_2:1634064_at:583:659; Interrogation_Position=387; Antisense; TAACTGGCCAGGTCACCAAGTGCAA
>probe:Drosophila_2:1634064_at:638:241; Interrogation_Position=444; Antisense; AATACTGCGTGGATCTCTGCGAAGT
>probe:Drosophila_2:1634064_at:380:527; Interrogation_Position=492; Antisense; GGGACAGTCCGCTATAGAACTTTTG
>probe:Drosophila_2:1634064_at:392:53; Interrogation_Position=529; Antisense; ATGCTTTCACTACCTCATGTCTAAA
>probe:Drosophila_2:1634064_at:713:315; Interrogation_Position=78; Antisense; GCCTCATTGTGGTTGTAAGCTCGAT
>probe:Drosophila_2:1634064_at:206:207; Interrogation_Position=94; Antisense; AAGCTCGATGGCAGTTCTGGTCCAA

Paste this into a BLAST search page for me
GTTAGTCCGTTAGTCACATTCAAAGAACGCACTATAGCTTTTGCTCCGATTTTGCTCCGATAATGTGGCGCCCAAATCAGGTCCTTCAGTGTCCGGATAAGACCTGGCAATCATCTGCATGGACAAGTGTAGTGGATAGCTCCTGCTCAGGAAACAGCATGTTCGTCTGCACCAGACCACCTTCCAGATGTGCGATGGCATAACTGGCCAGGTCACCAAGTGCAAAATACTGCGTGGATCTCTGCGAAGTGGGACAGTCCGCTATAGAACTTTTGATGCTTTCACTACCTCATGTCTAAAGCCTCATTGTGGTTGTAAGCTCGATAAGCTCGATGGCAGTTCTGGTCCAA

Full Affymetrix probeset data:

Annotations for 1634064_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720