FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634068_at:

>probe:Drosophila_2:1634068_at:719:455; Interrogation_Position=1016; Antisense; GATAGCAGTATACAGGACGCAGTTA
>probe:Drosophila_2:1634068_at:451:83; Interrogation_Position=1057; Antisense; AGTGGAACACACTGCTGATCCCAAG
>probe:Drosophila_2:1634068_at:671:333; Interrogation_Position=1070; Antisense; GCTGATCCCAAGACTACAAACTTTA
>probe:Drosophila_2:1634068_at:621:567; Interrogation_Position=552; Antisense; GGCAGTAATCCGTTCGTTGGCGAGA
>probe:Drosophila_2:1634068_at:570:573; Interrogation_Position=570; Antisense; GGCGAGACAATCTTCCTGCTAGAAA
>probe:Drosophila_2:1634068_at:509:541; Interrogation_Position=681; Antisense; GGTTGGTTGAATCGGCATCTCTGCA
>probe:Drosophila_2:1634068_at:528:237; Interrogation_Position=690; Antisense; AATCGGCATCTCTGCAGGCGGTTTT
>probe:Drosophila_2:1634068_at:246:543; Interrogation_Position=786; Antisense; GGATCCTTACCAGCAAACTCAATTT
>probe:Drosophila_2:1634068_at:526:279; Interrogation_Position=847; Antisense; CCGAGTATATTTCTTTTTTAGCCAG
>probe:Drosophila_2:1634068_at:667:651; Interrogation_Position=875; Antisense; TCAACATTTATGTATTCGCGCAAAT
>probe:Drosophila_2:1634068_at:63:515; Interrogation_Position=929; Antisense; GTGTACAAATGTCCCGAAGCGGCAA
>probe:Drosophila_2:1634068_at:21:359; Interrogation_Position=950; Antisense; GCAAAAGTGTGACTCCCTCAGGGAA
>probe:Drosophila_2:1634068_at:345:81; Interrogation_Position=969; Antisense; AGGGAACAGACAATCCTGGCTTTTT
>probe:Drosophila_2:1634068_at:275:47; Interrogation_Position=981; Antisense; ATCCTGGCTTTTTGTGCGAGTCAAC

Paste this into a BLAST search page for me
GATAGCAGTATACAGGACGCAGTTAAGTGGAACACACTGCTGATCCCAAGGCTGATCCCAAGACTACAAACTTTAGGCAGTAATCCGTTCGTTGGCGAGAGGCGAGACAATCTTCCTGCTAGAAAGGTTGGTTGAATCGGCATCTCTGCAAATCGGCATCTCTGCAGGCGGTTTTGGATCCTTACCAGCAAACTCAATTTCCGAGTATATTTCTTTTTTAGCCAGTCAACATTTATGTATTCGCGCAAATGTGTACAAATGTCCCGAAGCGGCAAGCAAAAGTGTGACTCCCTCAGGGAAAGGGAACAGACAATCCTGGCTTTTTATCCTGGCTTTTTGTGCGAGTCAAC

Full Affymetrix probeset data:

Annotations for 1634068_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720