FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634070_at:

>probe:Drosophila_2:1634070_at:280:705; Interrogation_Position=105; Antisense; TTATGTGGGTGCTCTCTTCCAGTTC
>probe:Drosophila_2:1634070_at:457:507; Interrogation_Position=113; Antisense; GTGCTCTCTTCCAGTTCGTTTGCAT
>probe:Drosophila_2:1634070_at:419:93; Interrogation_Position=125; Antisense; AGTTCGTTTGCATTTCGGCCGCAGT
>probe:Drosophila_2:1634070_at:704:343; Interrogation_Position=134; Antisense; GCATTTCGGCCGCAGTATTGATGGA
>probe:Drosophila_2:1634070_at:231:5; Interrogation_Position=150; Antisense; ATTGATGGAGAATAACCCGGATGGC
>probe:Drosophila_2:1634070_at:480:365; Interrogation_Position=159; Antisense; GAATAACCCGGATGGCCAAAGTAAT
>probe:Drosophila_2:1634070_at:569:65; Interrogation_Position=170; Antisense; ATGGCCAAAGTAATCCGGAGTCCGG
>probe:Drosophila_2:1634070_at:14:557; Interrogation_Position=227; Antisense; GGACGCGCCTGCACAAGATTCGTAA
>probe:Drosophila_2:1634070_at:714:315; Interrogation_Position=233; Antisense; GCCTGCACAAGATTCGTAAGCTGGA
>probe:Drosophila_2:1634070_at:272:349; Interrogation_Position=46; Antisense; GCAGCCCTGGACAAGTACGGCGACG
>probe:Drosophila_2:1634070_at:140:489; Interrogation_Position=60; Antisense; GTACGGCGACGAGGACATCTTCAGC
>probe:Drosophila_2:1634070_at:521:137; Interrogation_Position=68; Antisense; ACGAGGACATCTTCAGCTTGCTAAT
>probe:Drosophila_2:1634070_at:33:713; Interrogation_Position=79; Antisense; TTCAGCTTGCTAATCCGATACGGGC
>probe:Drosophila_2:1634070_at:402:29; Interrogation_Position=96; Antisense; ATACGGGCTTTATGTGGGTGCTCTC

Paste this into a BLAST search page for me
TTATGTGGGTGCTCTCTTCCAGTTCGTGCTCTCTTCCAGTTCGTTTGCATAGTTCGTTTGCATTTCGGCCGCAGTGCATTTCGGCCGCAGTATTGATGGAATTGATGGAGAATAACCCGGATGGCGAATAACCCGGATGGCCAAAGTAATATGGCCAAAGTAATCCGGAGTCCGGGGACGCGCCTGCACAAGATTCGTAAGCCTGCACAAGATTCGTAAGCTGGAGCAGCCCTGGACAAGTACGGCGACGGTACGGCGACGAGGACATCTTCAGCACGAGGACATCTTCAGCTTGCTAATTTCAGCTTGCTAATCCGATACGGGCATACGGGCTTTATGTGGGTGCTCTC

Full Affymetrix probeset data:

Annotations for 1634070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720