FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634071_at:

>probe:Drosophila_2:1634071_at:530:481; Interrogation_Position=3059; Antisense; GTATCCTTCGGGTCTGTGGGAACAT
>probe:Drosophila_2:1634071_at:126:47; Interrogation_Position=3104; Antisense; ATCCGCGGATGACCTCTTCATGAAG
>probe:Drosophila_2:1634071_at:609:713; Interrogation_Position=3120; Antisense; TTCATGAAGCGCTACACCGACAAGA
>probe:Drosophila_2:1634071_at:660:645; Interrogation_Position=3151; Antisense; TCATAGACTCCACACAGCTGTACGA
>probe:Drosophila_2:1634071_at:588:595; Interrogation_Position=3169; Antisense; TGTACGACCTTCATGAGCGAACGGC
>probe:Drosophila_2:1634071_at:352:137; Interrogation_Position=3189; Antisense; ACGGCGGCCACGGATTATTTTAGCA
>probe:Drosophila_2:1634071_at:671:673; Interrogation_Position=3209; Antisense; TAGCAAGACATTCCCGAGATCTCAC
>probe:Drosophila_2:1634071_at:576:97; Interrogation_Position=3225; Antisense; AGATCTCACCTCCAGCAGGGCATGA
>probe:Drosophila_2:1634071_at:269:529; Interrogation_Position=3278; Antisense; GGCGTCGACGGTAACCACTAATTTG
>probe:Drosophila_2:1634071_at:21:127; Interrogation_Position=3291; Antisense; ACCACTAATTTGTCGGGTGGCTCCT
>probe:Drosophila_2:1634071_at:324:529; Interrogation_Position=3320; Antisense; GGGTTACCCCAACGATTATGGTCTG
>probe:Drosophila_2:1634071_at:185:199; Interrogation_Position=3330; Antisense; AACGATTATGGTCTGCCTCTGGTGC
>probe:Drosophila_2:1634071_at:200:553; Interrogation_Position=3466; Antisense; GGAGCAGTCCGCACTTCAGTAGCCG
>probe:Drosophila_2:1634071_at:36:267; Interrogation_Position=3530; Antisense; CAGTTCACGGTCGAACGGCGAGGAA

Paste this into a BLAST search page for me
GTATCCTTCGGGTCTGTGGGAACATATCCGCGGATGACCTCTTCATGAAGTTCATGAAGCGCTACACCGACAAGATCATAGACTCCACACAGCTGTACGATGTACGACCTTCATGAGCGAACGGCACGGCGGCCACGGATTATTTTAGCATAGCAAGACATTCCCGAGATCTCACAGATCTCACCTCCAGCAGGGCATGAGGCGTCGACGGTAACCACTAATTTGACCACTAATTTGTCGGGTGGCTCCTGGGTTACCCCAACGATTATGGTCTGAACGATTATGGTCTGCCTCTGGTGCGGAGCAGTCCGCACTTCAGTAGCCGCAGTTCACGGTCGAACGGCGAGGAA

Full Affymetrix probeset data:

Annotations for 1634071_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720