Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634073_at:

>probe:Drosophila_2:1634073_at:361:595; Interrogation_Position=2842; Antisense; TGGGCGGCGAACTGCTTGCTAGACC
>probe:Drosophila_2:1634073_at:63:345; Interrogation_Position=2855; Antisense; GCTTGCTAGACCCAGACGAACTACA
>probe:Drosophila_2:1634073_at:372:661; Interrogation_Position=2876; Antisense; TACAATTGGCCAGCGTTCCGTTTTT
>probe:Drosophila_2:1634073_at:319:173; Interrogation_Position=2992; Antisense; AAAGAAACCCGCACTAGCAACCGAG
>probe:Drosophila_2:1634073_at:597:131; Interrogation_Position=3018; Antisense; ACCGCAGTCCAGCAATACAGCAATC
>probe:Drosophila_2:1634073_at:655:183; Interrogation_Position=3044; Antisense; AAAAGTCGGCTTCCACTCAGAAATT
>probe:Drosophila_2:1634073_at:569:393; Interrogation_Position=3063; Antisense; GAAATTGATTCTTCCGTTTCGGTCT
>probe:Drosophila_2:1634073_at:316:717; Interrogation_Position=3080; Antisense; TTCGGTCTTGCCATCTGCATTTGTC
>probe:Drosophila_2:1634073_at:651:627; Interrogation_Position=3113; Antisense; TCCACATTTGTTTGAGCCCCTCGAA
>probe:Drosophila_2:1634073_at:611:385; Interrogation_Position=3135; Antisense; GAACAAACTCTACATGCCACTGGTG
>probe:Drosophila_2:1634073_at:317:27; Interrogation_Position=3200; Antisense; ATACTTCATCTTCCAGAATGTTGTC
>probe:Drosophila_2:1634073_at:729:367; Interrogation_Position=3215; Antisense; GAATGTTGTCAGAACTCTTCCGAAC
>probe:Drosophila_2:1634073_at:390:179; Interrogation_Position=3269; Antisense; AAACAGACATACATCTCACCCGAAT
>probe:Drosophila_2:1634073_at:142:391; Interrogation_Position=3310; Antisense; GAAACCCAAGTGCACTTCCAACATA

Paste this into a BLAST search page for me
TGGGCGGCGAACTGCTTGCTAGACCGCTTGCTAGACCCAGACGAACTACATACAATTGGCCAGCGTTCCGTTTTTAAAGAAACCCGCACTAGCAACCGAGACCGCAGTCCAGCAATACAGCAATCAAAAGTCGGCTTCCACTCAGAAATTGAAATTGATTCTTCCGTTTCGGTCTTTCGGTCTTGCCATCTGCATTTGTCTCCACATTTGTTTGAGCCCCTCGAAGAACAAACTCTACATGCCACTGGTGATACTTCATCTTCCAGAATGTTGTCGAATGTTGTCAGAACTCTTCCGAACAAACAGACATACATCTCACCCGAATGAAACCCAAGTGCACTTCCAACATA

Full Affymetrix probeset data:

Annotations for 1634073_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime