Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634075_at:

>probe:Drosophila_2:1634075_at:290:277; Interrogation_Position=68680; Antisense; CTTTCAAGTTCCCATCGAGCGATAA
>probe:Drosophila_2:1634075_at:675:45; Interrogation_Position=68706; Antisense; ATCCGCTTCCAGTGCAACATACGAG
>probe:Drosophila_2:1634075_at:36:139; Interrogation_Position=68726; Antisense; ACGAGTCTGCTTTGGACGCTGTCAA
>probe:Drosophila_2:1634075_at:473:331; Interrogation_Position=68743; Antisense; GCTGTCAACCCGTCAATTGTGGTGG
>probe:Drosophila_2:1634075_at:307:245; Interrogation_Position=68757; Antisense; AATTGTGGTGGCTACAACGCCTTCG
>probe:Drosophila_2:1634075_at:421:27; Interrogation_Position=68799; Antisense; ATAGCGGATAACTCCACCGATGCGA
>probe:Drosophila_2:1634075_at:117:447; Interrogation_Position=68817; Antisense; GATGCGACCGCCATTGCCACGAATT
>probe:Drosophila_2:1634075_at:63:495; Interrogation_Position=68854; Antisense; GTCAACTGCGCGAAGAGATCACAAT
>probe:Drosophila_2:1634075_at:364:627; Interrogation_Position=68888; Antisense; TGCCATTTTGACATTCGAGAAGCGC
>probe:Drosophila_2:1634075_at:365:379; Interrogation_Position=68906; Antisense; GAAGCGCAGCGGTCAAGGTCTCAAT
>probe:Drosophila_2:1634075_at:515:15; Interrogation_Position=68994; Antisense; ATTATAGCACTGGTCATCACGGCAC
>probe:Drosophila_2:1634075_at:292:33; Interrogation_Position=69009; Antisense; ATCACGGCACTGCTGGCTCTTGTGG
>probe:Drosophila_2:1634075_at:544:479; Interrogation_Position=69048; Antisense; GTTTCCTGCTGGCTAATGGCCTACA
>probe:Drosophila_2:1634075_at:270:117; Interrogation_Position=69157; Antisense; AGCCAACGCCGGATTACATATCCTA

Paste this into a BLAST search page for me
CTTTCAAGTTCCCATCGAGCGATAAATCCGCTTCCAGTGCAACATACGAGACGAGTCTGCTTTGGACGCTGTCAAGCTGTCAACCCGTCAATTGTGGTGGAATTGTGGTGGCTACAACGCCTTCGATAGCGGATAACTCCACCGATGCGAGATGCGACCGCCATTGCCACGAATTGTCAACTGCGCGAAGAGATCACAATTGCCATTTTGACATTCGAGAAGCGCGAAGCGCAGCGGTCAAGGTCTCAATATTATAGCACTGGTCATCACGGCACATCACGGCACTGCTGGCTCTTGTGGGTTTCCTGCTGGCTAATGGCCTACAAGCCAACGCCGGATTACATATCCTA

Full Affymetrix probeset data:

Annotations for 1634075_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime