FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634076_at:

>probe:Drosophila_2:1634076_at:358:97; Interrogation_Position=290; Antisense; AGATCACCCGCATCGTGAATGCCGC
>probe:Drosophila_2:1634076_at:171:615; Interrogation_Position=305; Antisense; TGAATGCCGCCCATGAGGATCTGTA
>probe:Drosophila_2:1634076_at:517:57; Interrogation_Position=317; Antisense; ATGAGGATCTGTACGCCTGCGGCGT
>probe:Drosophila_2:1634076_at:237:163; Interrogation_Position=365; Antisense; AAATTGCCTCCGATGTGAGTGCCGC
>probe:Drosophila_2:1634076_at:301:111; Interrogation_Position=395; Antisense; AGCAACTGGTCTACGGTGGCTACAG
>probe:Drosophila_2:1634076_at:706:51; Interrogation_Position=441; Antisense; ATGCAACTCGTACAAGAACTCCGTG
>probe:Drosophila_2:1634076_at:651:107; Interrogation_Position=455; Antisense; AGAACTCCGTGCTGAAGCAGACCTG
>probe:Drosophila_2:1634076_at:328:619; Interrogation_Position=478; Antisense; TGCTTGGCCAAGTTCTATGTCCAGG
>probe:Drosophila_2:1634076_at:540:55; Interrogation_Position=500; Antisense; AGGCCACCGTCTATTTGGTCAGTGC
>probe:Drosophila_2:1634076_at:354:497; Interrogation_Position=577; Antisense; GTCTTCGCCGATGGCAATGTGTGCA
>probe:Drosophila_2:1634076_at:565:535; Interrogation_Position=631; Antisense; GGTCTCCAGGAGGTGAACAACAACA
>probe:Drosophila_2:1634076_at:30:673; Interrogation_Position=670; Antisense; TACCGTCGTCGCTAGGTGAACACAA
>probe:Drosophila_2:1634076_at:535:189; Interrogation_Position=694; Antisense; AACTTATTTACCTGGATTCTGCAAA
>probe:Drosophila_2:1634076_at:336:349; Interrogation_Position=773; Antisense; GCAGTGTTGCTTGTTGCAGTGTGAT

Paste this into a BLAST search page for me
AGATCACCCGCATCGTGAATGCCGCTGAATGCCGCCCATGAGGATCTGTAATGAGGATCTGTACGCCTGCGGCGTAAATTGCCTCCGATGTGAGTGCCGCAGCAACTGGTCTACGGTGGCTACAGATGCAACTCGTACAAGAACTCCGTGAGAACTCCGTGCTGAAGCAGACCTGTGCTTGGCCAAGTTCTATGTCCAGGAGGCCACCGTCTATTTGGTCAGTGCGTCTTCGCCGATGGCAATGTGTGCAGGTCTCCAGGAGGTGAACAACAACATACCGTCGTCGCTAGGTGAACACAAAACTTATTTACCTGGATTCTGCAAAGCAGTGTTGCTTGTTGCAGTGTGAT

Full Affymetrix probeset data:

Annotations for 1634076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720