FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634077_at:

>probe:Drosophila_2:1634077_at:455:645; Interrogation_Position=677; Antisense; TCTTTGACCGCGTTATCGAAAATCG
>probe:Drosophila_2:1634077_at:689:387; Interrogation_Position=694; Antisense; GAAAATCGCAAAGCGCTGCGCGCAG
>probe:Drosophila_2:1634077_at:535:353; Interrogation_Position=715; Antisense; GCAGCCCTAGCATTCGGAGTGAGCA
>probe:Drosophila_2:1634077_at:214:117; Interrogation_Position=723; Antisense; AGCATTCGGAGTGAGCAGCTCCAAC
>probe:Drosophila_2:1634077_at:149:1; Interrogation_Position=754; Antisense; AGTCCGCCCGACAGGCGACGTTTTG
>probe:Drosophila_2:1634077_at:411:397; Interrogation_Position=763; Antisense; GACAGGCGACGTTTTGGCCCGACCA
>probe:Drosophila_2:1634077_at:591:581; Interrogation_Position=777; Antisense; TGGCCCGACCAGTGCCAAAATGGAA
>probe:Drosophila_2:1634077_at:718:167; Interrogation_Position=794; Antisense; AAATGGAAGACAGCGTCTTGCCCCT
>probe:Drosophila_2:1634077_at:577:303; Interrogation_Position=819; Antisense; CCTGGATACCCAAGACCTCAAGTGA
>probe:Drosophila_2:1634077_at:581:455; Interrogation_Position=823; Antisense; GATACCCAAGACCTCAAGTGACTAA
>probe:Drosophila_2:1634077_at:75:511; Interrogation_Position=840; Antisense; GTGACTAATGCACTCAATTCAGTAG
>probe:Drosophila_2:1634077_at:488:599; Interrogation_Position=848; Antisense; TGCACTCAATTCAGTAGTTCTAAGT
>probe:Drosophila_2:1634077_at:72:93; Interrogation_Position=863; Antisense; AGTTCTAAGTTGTAGTTATCGTACG
>probe:Drosophila_2:1634077_at:297:475; Interrogation_Position=877; Antisense; GTTATCGTACGGGAAGCATTACAAA

Paste this into a BLAST search page for me
TCTTTGACCGCGTTATCGAAAATCGGAAAATCGCAAAGCGCTGCGCGCAGGCAGCCCTAGCATTCGGAGTGAGCAAGCATTCGGAGTGAGCAGCTCCAACAGTCCGCCCGACAGGCGACGTTTTGGACAGGCGACGTTTTGGCCCGACCATGGCCCGACCAGTGCCAAAATGGAAAAATGGAAGACAGCGTCTTGCCCCTCCTGGATACCCAAGACCTCAAGTGAGATACCCAAGACCTCAAGTGACTAAGTGACTAATGCACTCAATTCAGTAGTGCACTCAATTCAGTAGTTCTAAGTAGTTCTAAGTTGTAGTTATCGTACGGTTATCGTACGGGAAGCATTACAAA

Full Affymetrix probeset data:

Annotations for 1634077_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720