FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634078_at:

>probe:Drosophila_2:1634078_at:26:217; Interrogation_Position=2475; Antisense; AAGTTGGCGCGAACCCAGGCAGGAT
>probe:Drosophila_2:1634078_at:96:95; Interrogation_Position=2539; Antisense; AGATTCCCATTTATGTACGGCCGTG
>probe:Drosophila_2:1634078_at:37:319; Interrogation_Position=2558; Antisense; GCCGTGATTCCTCCCTAAGATAAGA
>probe:Drosophila_2:1634078_at:464:459; Interrogation_Position=2592; Antisense; GATTACCCTTGAGTCAATGGCTTTT
>probe:Drosophila_2:1634078_at:621:405; Interrogation_Position=2649; Antisense; GAGCTAGCTGTTTCTTTTCTACGGA
>probe:Drosophila_2:1634078_at:675:669; Interrogation_Position=2668; Antisense; TACGGAAAAGATCGACCTGCCCTCA
>probe:Drosophila_2:1634078_at:511:423; Interrogation_Position=2695; Antisense; GAGACATATGCTCGCTTCAATAGTA
>probe:Drosophila_2:1634078_at:341:233; Interrogation_Position=2803; Antisense; AATGCTCTATTTGTCAGTCTTTGAT
>probe:Drosophila_2:1634078_at:120:461; Interrogation_Position=2825; Antisense; GATTATATTAATAGGTCAGCCCGTT
>probe:Drosophila_2:1634078_at:487:647; Interrogation_Position=2840; Antisense; TCAGCCCGTTTTTGTCTATTTTCGA
>probe:Drosophila_2:1634078_at:47:247; Interrogation_Position=2903; Antisense; AATTGTGTAACTCTTGTCCTGGTAT
>probe:Drosophila_2:1634078_at:45:503; Interrogation_Position=2918; Antisense; GTCCTGGTATTTTGGTGCACTTGCT
>probe:Drosophila_2:1634078_at:538:355; Interrogation_Position=2934; Antisense; GCACTTGCTGCAGAAATCATTTGAC
>probe:Drosophila_2:1634078_at:701:705; Interrogation_Position=2992; Antisense; TTAGAACGCTAACCTAACATCCGCC

Paste this into a BLAST search page for me
AAGTTGGCGCGAACCCAGGCAGGATAGATTCCCATTTATGTACGGCCGTGGCCGTGATTCCTCCCTAAGATAAGAGATTACCCTTGAGTCAATGGCTTTTGAGCTAGCTGTTTCTTTTCTACGGATACGGAAAAGATCGACCTGCCCTCAGAGACATATGCTCGCTTCAATAGTAAATGCTCTATTTGTCAGTCTTTGATGATTATATTAATAGGTCAGCCCGTTTCAGCCCGTTTTTGTCTATTTTCGAAATTGTGTAACTCTTGTCCTGGTATGTCCTGGTATTTTGGTGCACTTGCTGCACTTGCTGCAGAAATCATTTGACTTAGAACGCTAACCTAACATCCGCC

Full Affymetrix probeset data:

Annotations for 1634078_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720