FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634079_at:

>probe:Drosophila_2:1634079_at:511:103; Interrogation_Position=1008; Antisense; AGACCGATGAAACACGACGCCGAGA
>probe:Drosophila_2:1634079_at:266:411; Interrogation_Position=1023; Antisense; GACGCCGAGAATTCTATACCTAAGT
>probe:Drosophila_2:1634079_at:527:421; Interrogation_Position=483; Antisense; GAGCAACTGCTCTTTAAGATCCTTT
>probe:Drosophila_2:1634079_at:130:657; Interrogation_Position=497; Antisense; TAAGATCCTTTTGCCTTTGCACAAG
>probe:Drosophila_2:1634079_at:574:357; Interrogation_Position=515; Antisense; GCACAAGCCGCCATCGTTAACAAAG
>probe:Drosophila_2:1634079_at:87:61; Interrogation_Position=607; Antisense; ATGTCAAAGGTCTTCTACGGCTCTG
>probe:Drosophila_2:1634079_at:610:485; Interrogation_Position=630; Antisense; TGGCCGAAGACGTCCTTTACTAAGG
>probe:Drosophila_2:1634079_at:322:295; Interrogation_Position=782; Antisense; CGAGCACACTCTTCTTTTGTGGAAA
>probe:Drosophila_2:1634079_at:24:705; Interrogation_Position=826; Antisense; TTATACATCGAAACCACGCGCTCAT
>probe:Drosophila_2:1634079_at:436:35; Interrogation_Position=849; Antisense; ATCATGCCCATTGTATATCCACACG
>probe:Drosophila_2:1634079_at:709:367; Interrogation_Position=920; Antisense; GAATGCCTCCATTGCTTTATGTACT
>probe:Drosophila_2:1634079_at:494:233; Interrogation_Position=960; Antisense; AATCCGATGCTTAGATGCCTGACTA
>probe:Drosophila_2:1634079_at:100:305; Interrogation_Position=976; Antisense; GCCTGACTACTGTATGCATGAGCAC
>probe:Drosophila_2:1634079_at:521:347; Interrogation_Position=991; Antisense; GCATGAGCACCGATCATAGACCGAT

Paste this into a BLAST search page for me
AGACCGATGAAACACGACGCCGAGAGACGCCGAGAATTCTATACCTAAGTGAGCAACTGCTCTTTAAGATCCTTTTAAGATCCTTTTGCCTTTGCACAAGGCACAAGCCGCCATCGTTAACAAAGATGTCAAAGGTCTTCTACGGCTCTGTGGCCGAAGACGTCCTTTACTAAGGCGAGCACACTCTTCTTTTGTGGAAATTATACATCGAAACCACGCGCTCATATCATGCCCATTGTATATCCACACGGAATGCCTCCATTGCTTTATGTACTAATCCGATGCTTAGATGCCTGACTAGCCTGACTACTGTATGCATGAGCACGCATGAGCACCGATCATAGACCGAT

Full Affymetrix probeset data:

Annotations for 1634079_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720