FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634080_at:

>probe:Drosophila_2:1634080_at:51:543; Interrogation_Position=203; Antisense; GGATTCTCGGCGGTATTTGGACTGC
>probe:Drosophila_2:1634080_at:50:19; Interrogation_Position=217; Antisense; ATTTGGACTGCTCCGGGTAATCTTC
>probe:Drosophila_2:1634080_at:574:587; Interrogation_Position=289; Antisense; TGGAGTCCTGGAACTGGCACCTTTG
>probe:Drosophila_2:1634080_at:289:691; Interrogation_Position=310; Antisense; TTTGCCCCTGGCCAATATGGATTTC
>probe:Drosophila_2:1634080_at:304:459; Interrogation_Position=329; Antisense; GATTTCTATATGCAGTCCACCGGGT
>probe:Drosophila_2:1634080_at:344:7; Interrogation_Position=362; Antisense; ATTGCCTTGGGACATGCCTTCTTCG
>probe:Drosophila_2:1634080_at:510:291; Interrogation_Position=385; Antisense; CGTGCTTCCACTGTTTTGCGATTTG
>probe:Drosophila_2:1634080_at:424:325; Interrogation_Position=433; Antisense; GCGAGATTGTGCCTTCAGCGACAGC
>probe:Drosophila_2:1634080_at:73:401; Interrogation_Position=452; Antisense; GACAGCTTGCGGAATCTCACGGTTC
>probe:Drosophila_2:1634080_at:539:593; Interrogation_Position=477; Antisense; TGGGCAATATTGTGTCCCTCGGCTT
>probe:Drosophila_2:1634080_at:499:279; Interrogation_Position=527; Antisense; CTCTATTTGCGAATGGTGCTGGTCA
>probe:Drosophila_2:1634080_at:293:701; Interrogation_Position=636; Antisense; TTTTTATGCACCTGCTCGGCAAGGC
>probe:Drosophila_2:1634080_at:533:343; Interrogation_Position=716; Antisense; GCTTCGAGGGTTTCATTGTACCGCT
>probe:Drosophila_2:1634080_at:129:3; Interrogation_Position=730; Antisense; ATTGTACCGCTTAATTTTCCATGAA

Paste this into a BLAST search page for me
GGATTCTCGGCGGTATTTGGACTGCATTTGGACTGCTCCGGGTAATCTTCTGGAGTCCTGGAACTGGCACCTTTGTTTGCCCCTGGCCAATATGGATTTCGATTTCTATATGCAGTCCACCGGGTATTGCCTTGGGACATGCCTTCTTCGCGTGCTTCCACTGTTTTGCGATTTGGCGAGATTGTGCCTTCAGCGACAGCGACAGCTTGCGGAATCTCACGGTTCTGGGCAATATTGTGTCCCTCGGCTTCTCTATTTGCGAATGGTGCTGGTCATTTTTATGCACCTGCTCGGCAAGGCGCTTCGAGGGTTTCATTGTACCGCTATTGTACCGCTTAATTTTCCATGAA

Full Affymetrix probeset data:

Annotations for 1634080_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720