Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634081_at:

>probe:Drosophila_2:1634081_at:293:551; Interrogation_Position=1056; Antisense; GGAGATCGTGTCCATCTTGCAGAAC
>probe:Drosophila_2:1634081_at:705:361; Interrogation_Position=1148; Antisense; GCAATCTCAGGCGAGCACTTTTGAT
>probe:Drosophila_2:1634081_at:213:319; Interrogation_Position=1200; Antisense; GCCGTTTACCGCCAATCAGGAGATT
>probe:Drosophila_2:1634081_at:164:77; Interrogation_Position=1217; Antisense; AGGAGATTCCCGACCTGGACTGGCA
>probe:Drosophila_2:1634081_at:388:81; Interrogation_Position=1241; Antisense; AGGTGTTCCTGCGTGAGACAGCATC
>probe:Drosophila_2:1634081_at:420:417; Interrogation_Position=1279; Antisense; GAGCAAACGCCTGCCAAACTGGAGA
>probe:Drosophila_2:1634081_at:508:109; Interrogation_Position=1301; Antisense; AGAAGATCCGCGAACGCCTGTACGA
>probe:Drosophila_2:1634081_at:199:489; Interrogation_Position=1320; Antisense; GTACGAGCTACTCACGCAAGGCGTT
>probe:Drosophila_2:1634081_at:421:225; Interrogation_Position=1337; Antisense; AAGGCGTTCCACCTAATCTCATATT
>probe:Drosophila_2:1634081_at:615:331; Interrogation_Position=1364; Antisense; GCGGCCTGGTCGAACAGCTGGTTAA
>probe:Drosophila_2:1634081_at:615:225; Interrogation_Position=1408; Antisense; AAGGCAAAGACGCTCGAGTTCGCCA
>probe:Drosophila_2:1634081_at:318:577; Interrogation_Position=1459; Antisense; GGCGCCAAGCACATTTTTCATCTTG
>probe:Drosophila_2:1634081_at:692:119; Interrogation_Position=1485; Antisense; AGCGTTCGTCGCTCAGTTTATGAAC
>probe:Drosophila_2:1634081_at:552:171; Interrogation_Position=1518; Antisense; AAAGTTCCTTTCTGAGCTGGACATG

Paste this into a BLAST search page for me
GGAGATCGTGTCCATCTTGCAGAACGCAATCTCAGGCGAGCACTTTTGATGCCGTTTACCGCCAATCAGGAGATTAGGAGATTCCCGACCTGGACTGGCAAGGTGTTCCTGCGTGAGACAGCATCGAGCAAACGCCTGCCAAACTGGAGAAGAAGATCCGCGAACGCCTGTACGAGTACGAGCTACTCACGCAAGGCGTTAAGGCGTTCCACCTAATCTCATATTGCGGCCTGGTCGAACAGCTGGTTAAAAGGCAAAGACGCTCGAGTTCGCCAGGCGCCAAGCACATTTTTCATCTTGAGCGTTCGTCGCTCAGTTTATGAACAAAGTTCCTTTCTGAGCTGGACATG

Full Affymetrix probeset data:

Annotations for 1634081_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime