FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634082_at:

>probe:Drosophila_2:1634082_at:711:517; Interrogation_Position=450; Antisense; GTGGGCAGCGATTATTCTTTGTTCA
>probe:Drosophila_2:1634082_at:686:639; Interrogation_Position=517; Antisense; TCGGCGGCCGTTGGGTCATCAATAT
>probe:Drosophila_2:1634082_at:195:121; Interrogation_Position=557; Antisense; AGCGGAGCTCGACAAGCTTTGGTTA
>probe:Drosophila_2:1634082_at:1:443; Interrogation_Position=582; Antisense; GATGTGCTACTCATACTGATTGGCG
>probe:Drosophila_2:1634082_at:425:713; Interrogation_Position=601; Antisense; TTGGCGAGGCCTTTGAAAACACCGA
>probe:Drosophila_2:1634082_at:10:131; Interrogation_Position=621; Antisense; ACCGAGGAAGTCTGCGGCGCCGTTA
>probe:Drosophila_2:1634082_at:529:693; Interrogation_Position=673; Antisense; TTTCGATTTGGACCGCCAACGGGCA
>probe:Drosophila_2:1634082_at:292:199; Interrogation_Position=699; Antisense; AACGAGCTGGCCGTCATGGAGATTG
>probe:Drosophila_2:1634082_at:343:3; Interrogation_Position=720; Antisense; ATTGGACTCAAGTTACGCGACCTGC
>probe:Drosophila_2:1634082_at:673:487; Interrogation_Position=770; Antisense; GTACCAGCTGCACAAGGACACTATG
>probe:Drosophila_2:1634082_at:707:539; Interrogation_Position=821; Antisense; GGTTTATTGCGTGTAAGCCGTCTCC
>probe:Drosophila_2:1634082_at:32:659; Interrogation_Position=834; Antisense; TAAGCCGTCTCCGTTTTGGATGCCA
>probe:Drosophila_2:1634082_at:241:705; Interrogation_Position=901; Antisense; TTATGCCTCTGAATGCTGTTTCCAG
>probe:Drosophila_2:1634082_at:481:479; Interrogation_Position=918; Antisense; GTTTCCAGCGCGTGTATCCGAAAAA

Paste this into a BLAST search page for me
GTGGGCAGCGATTATTCTTTGTTCATCGGCGGCCGTTGGGTCATCAATATAGCGGAGCTCGACAAGCTTTGGTTAGATGTGCTACTCATACTGATTGGCGTTGGCGAGGCCTTTGAAAACACCGAACCGAGGAAGTCTGCGGCGCCGTTATTTCGATTTGGACCGCCAACGGGCAAACGAGCTGGCCGTCATGGAGATTGATTGGACTCAAGTTACGCGACCTGCGTACCAGCTGCACAAGGACACTATGGGTTTATTGCGTGTAAGCCGTCTCCTAAGCCGTCTCCGTTTTGGATGCCATTATGCCTCTGAATGCTGTTTCCAGGTTTCCAGCGCGTGTATCCGAAAAA

Full Affymetrix probeset data:

Annotations for 1634082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720