Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634083_at:

>probe:Drosophila_2:1634083_at:295:127; Interrogation_Position=8571; Antisense; ACCCACGGATAAAGCATTCTCATCG
>probe:Drosophila_2:1634083_at:382:345; Interrogation_Position=8584; Antisense; GCATTCTCATCGGAATCATTAGATT
>probe:Drosophila_2:1634083_at:204:461; Interrogation_Position=8605; Antisense; GATTTTTATGACAATTGCCCAGGCA
>probe:Drosophila_2:1634083_at:583:245; Interrogation_Position=8617; Antisense; AATTGCCCAGGCAGCGTCAGCAGCC
>probe:Drosophila_2:1634083_at:73:159; Interrogation_Position=8655; Antisense; ACACAGCAAATCACGCGCCAAACAT
>probe:Drosophila_2:1634083_at:281:239; Interrogation_Position=8663; Antisense; AATCACGCGCCAAACATCGAATTAA
>probe:Drosophila_2:1634083_at:436:659; Interrogation_Position=8685; Antisense; TAACGACAGTCCATCACATTGAACG
>probe:Drosophila_2:1634083_at:579:503; Interrogation_Position=8693; Antisense; GTCCATCACATTGAACGTTCCACAA
>probe:Drosophila_2:1634083_at:645:707; Interrogation_Position=8734; Antisense; TTCAAACTGCAACTTAAGACAACAT
>probe:Drosophila_2:1634083_at:438:661; Interrogation_Position=8787; Antisense; TAACACCATGATTGGGAAACATATG
>probe:Drosophila_2:1634083_at:352:629; Interrogation_Position=8816; Antisense; TCGTAGTTATATAAGCTTTGCCAAA
>probe:Drosophila_2:1634083_at:121:363; Interrogation_Position=8843; Antisense; GAATTATTGTCCCAACACTCCAAAC
>probe:Drosophila_2:1634083_at:101:311; Interrogation_Position=8854; Antisense; CCAACACTCCAAACGATTTCACTTT
>probe:Drosophila_2:1634083_at:136:459; Interrogation_Position=8868; Antisense; GATTTCACTTTTGTAATATCGAACA

Paste this into a BLAST search page for me
ACCCACGGATAAAGCATTCTCATCGGCATTCTCATCGGAATCATTAGATTGATTTTTATGACAATTGCCCAGGCAAATTGCCCAGGCAGCGTCAGCAGCCACACAGCAAATCACGCGCCAAACATAATCACGCGCCAAACATCGAATTAATAACGACAGTCCATCACATTGAACGGTCCATCACATTGAACGTTCCACAATTCAAACTGCAACTTAAGACAACATTAACACCATGATTGGGAAACATATGTCGTAGTTATATAAGCTTTGCCAAAGAATTATTGTCCCAACACTCCAAACCCAACACTCCAAACGATTTCACTTTGATTTCACTTTTGTAATATCGAACA

Full Affymetrix probeset data:

Annotations for 1634083_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime