FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634084_at:

>probe:Drosophila_2:1634084_at:583:465; Interrogation_Position=3840; Antisense; GATTGTTTTGTGACGGTGACCACCA
>probe:Drosophila_2:1634084_at:660:511; Interrogation_Position=3855; Antisense; GTGACCACCACTGCTAGTCAGGTAG
>probe:Drosophila_2:1634084_at:213:113; Interrogation_Position=3878; Antisense; AGCACTAAAACTACAATCCACGGGA
>probe:Drosophila_2:1634084_at:636:45; Interrogation_Position=3906; Antisense; ATCCCCAAGACTACGACGAGGCATG
>probe:Drosophila_2:1634084_at:42:569; Interrogation_Position=3925; Antisense; GGCATGTCATGCCACAAACCAAGTT
>probe:Drosophila_2:1634084_at:551:175; Interrogation_Position=3940; Antisense; AAACCAAGTTGTGTGCTGCCACTCG
>probe:Drosophila_2:1634084_at:292:509; Interrogation_Position=3952; Antisense; GTGCTGCCACTCGACAGGATGATGC
>probe:Drosophila_2:1634084_at:27:391; Interrogation_Position=4026; Antisense; GAAACCCTTGAGGACATGGTGCAGA
>probe:Drosophila_2:1634084_at:434:679; Interrogation_Position=4055; Antisense; TAGGGCACTGCCGTTTCCAGAAAAA
>probe:Drosophila_2:1634084_at:333:553; Interrogation_Position=4172; Antisense; GGACCTAGAAGATAACCCACATAAT
>probe:Drosophila_2:1634084_at:523:43; Interrogation_Position=4229; Antisense; ATCCGGTCAACCTACAACGAGCAAT
>probe:Drosophila_2:1634084_at:694:389; Interrogation_Position=4268; Antisense; GAAACACATGAATACCGAGCACTGA
>probe:Drosophila_2:1634084_at:75:421; Interrogation_Position=4284; Antisense; GAGCACTGAATGCTGTTCACTAGAT
>probe:Drosophila_2:1634084_at:545:253; Interrogation_Position=4313; Antisense; CAACGACTACAATAGCCTGCTGATA

Paste this into a BLAST search page for me
GATTGTTTTGTGACGGTGACCACCAGTGACCACCACTGCTAGTCAGGTAGAGCACTAAAACTACAATCCACGGGAATCCCCAAGACTACGACGAGGCATGGGCATGTCATGCCACAAACCAAGTTAAACCAAGTTGTGTGCTGCCACTCGGTGCTGCCACTCGACAGGATGATGCGAAACCCTTGAGGACATGGTGCAGATAGGGCACTGCCGTTTCCAGAAAAAGGACCTAGAAGATAACCCACATAATATCCGGTCAACCTACAACGAGCAATGAAACACATGAATACCGAGCACTGAGAGCACTGAATGCTGTTCACTAGATCAACGACTACAATAGCCTGCTGATA

Full Affymetrix probeset data:

Annotations for 1634084_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720