FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634085_at:

>probe:Drosophila_2:1634085_at:58:97; Interrogation_Position=1069; Antisense; AGATCTGTGCCCGATATTTCCTTGG
>probe:Drosophila_2:1634085_at:229:19; Interrogation_Position=1084; Antisense; ATTTCCTTGGCCCATTTGCGTCGTA
>probe:Drosophila_2:1634085_at:437:501; Interrogation_Position=1103; Antisense; GTCGTACGGCCAAGTTCTCAGATGA
>probe:Drosophila_2:1634085_at:224:75; Interrogation_Position=1127; Antisense; AGGACTACAATGGTCTGGCCTGTTG
>probe:Drosophila_2:1634085_at:86:539; Interrogation_Position=1151; Antisense; GGTACGGGCGCATAGACTCCAAGTT
>probe:Drosophila_2:1634085_at:637:93; Interrogation_Position=1172; Antisense; AGTTCGCAGAGCTGAAACTGGCCAT
>probe:Drosophila_2:1634085_at:690:419; Interrogation_Position=1198; Antisense; GAGCAGCACTTTGTGGATCTGTACA
>probe:Drosophila_2:1634085_at:521:511; Interrogation_Position=1309; Antisense; GTGAGACCGCAAAGGCCGCCCAGAG
>probe:Drosophila_2:1634085_at:725:423; Interrogation_Position=1331; Antisense; GAGACCTTAATTCCTCCAGTAGAAT
>probe:Drosophila_2:1634085_at:20:379; Interrogation_Position=1390; Antisense; GAAGCTGAAGCGGAGACCACCACAT
>probe:Drosophila_2:1634085_at:534:515; Interrogation_Position=1432; Antisense; GTGTACATCCGGACCAAGAACTATG
>probe:Drosophila_2:1634085_at:661:423; Interrogation_Position=1506; Antisense; GAGACTCGGCTTGATCCAGTATATC
>probe:Drosophila_2:1634085_at:260:481; Interrogation_Position=1524; Antisense; GTATATCAGTGCTTCGGAGCCGAGC
>probe:Drosophila_2:1634085_at:510:277; Interrogation_Position=1600; Antisense; CTAGTGAAACTCCTTTTCCCAAGTG

Paste this into a BLAST search page for me
AGATCTGTGCCCGATATTTCCTTGGATTTCCTTGGCCCATTTGCGTCGTAGTCGTACGGCCAAGTTCTCAGATGAAGGACTACAATGGTCTGGCCTGTTGGGTACGGGCGCATAGACTCCAAGTTAGTTCGCAGAGCTGAAACTGGCCATGAGCAGCACTTTGTGGATCTGTACAGTGAGACCGCAAAGGCCGCCCAGAGGAGACCTTAATTCCTCCAGTAGAATGAAGCTGAAGCGGAGACCACCACATGTGTACATCCGGACCAAGAACTATGGAGACTCGGCTTGATCCAGTATATCGTATATCAGTGCTTCGGAGCCGAGCCTAGTGAAACTCCTTTTCCCAAGTG

Full Affymetrix probeset data:

Annotations for 1634085_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720