FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634087_at:

>probe:Drosophila_2:1634087_at:219:455; Interrogation_Position=1935; Antisense; GATAAGCCCGGTCTGAATTTCTACA
>probe:Drosophila_2:1634087_at:42:615; Interrogation_Position=1948; Antisense; TGAATTTCTACATGGCTCCCGTCAT
>probe:Drosophila_2:1634087_at:517:337; Interrogation_Position=1962; Antisense; GCTCCCGTCATAATCATCATCATAT
>probe:Drosophila_2:1634087_at:533:21; Interrogation_Position=1983; Antisense; ATATTCTCCTTCTTTATTGCTCACA
>probe:Drosophila_2:1634087_at:205:259; Interrogation_Position=2004; Antisense; CACATTATCCTCTCGCTTTTTGAGA
>probe:Drosophila_2:1634087_at:694:83; Interrogation_Position=2033; Antisense; AGTGGATACCTTATTCCTCTGTGTC
>probe:Drosophila_2:1634087_at:266:229; Interrogation_Position=2076; Antisense; AATGGTCGCTCTGGTCGTTGGGCAC
>probe:Drosophila_2:1634087_at:695:415; Interrogation_Position=2151; Antisense; GAGCCGCCCATCGAAGTTGTTCAAA
>probe:Drosophila_2:1634087_at:19:607; Interrogation_Position=2176; Antisense; TGATGCCCATCAACAAGCAGCCATT
>probe:Drosophila_2:1634087_at:416:351; Interrogation_Position=2192; Antisense; GCAGCCATTTAGTATTACCCGACTC
>probe:Drosophila_2:1634087_at:200:75; Interrogation_Position=2233; Antisense; AGGTAGCTCCCATGTCGGCGGATTA
>probe:Drosophila_2:1634087_at:642:97; Interrogation_Position=2274; Antisense; AGATGCTTTCGCTTTTGTATTCCAA
>probe:Drosophila_2:1634087_at:80:703; Interrogation_Position=2286; Antisense; TTTTGTATTCCAAGCGCAGAACCCC
>probe:Drosophila_2:1634087_at:97:391; Interrogation_Position=2313; Antisense; GAAACTCAACGCACATCTCATTAGG

Paste this into a BLAST search page for me
GATAAGCCCGGTCTGAATTTCTACATGAATTTCTACATGGCTCCCGTCATGCTCCCGTCATAATCATCATCATATATATTCTCCTTCTTTATTGCTCACACACATTATCCTCTCGCTTTTTGAGAAGTGGATACCTTATTCCTCTGTGTCAATGGTCGCTCTGGTCGTTGGGCACGAGCCGCCCATCGAAGTTGTTCAAATGATGCCCATCAACAAGCAGCCATTGCAGCCATTTAGTATTACCCGACTCAGGTAGCTCCCATGTCGGCGGATTAAGATGCTTTCGCTTTTGTATTCCAATTTTGTATTCCAAGCGCAGAACCCCGAAACTCAACGCACATCTCATTAGG

Full Affymetrix probeset data:

Annotations for 1634087_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720