FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634091_at:

>probe:Drosophila_2:1634091_at:470:323; Interrogation_Position=105; Antisense; GCGATCTTACGGTCAGGATAGCTCC
>probe:Drosophila_2:1634091_at:348:611; Interrogation_Position=14; Antisense; TGAACAAGTTCGCTACTCTGGCAGT
>probe:Drosophila_2:1634091_at:436:81; Interrogation_Position=170; Antisense; AGGGTCAGCAGCGTTATGAGCGCCC
>probe:Drosophila_2:1634091_at:36:57; Interrogation_Position=185; Antisense; ATGAGCGCCCCGTGGAGATCATCGC
>probe:Drosophila_2:1634091_at:538:633; Interrogation_Position=249; Antisense; TCCCATCCAGGTCAGCGGTGGATAT
>probe:Drosophila_2:1634091_at:655:659; Interrogation_Position=292; Antisense; TACAACGGTGGCAACTACCGTCGTG
>probe:Drosophila_2:1634091_at:96:387; Interrogation_Position=378; Antisense; GAACAACTACAAGGCTTACGTCTCG
>probe:Drosophila_2:1634091_at:548:89; Interrogation_Position=410; Antisense; AGTACAGCAAGGTGATCCTGCCCAT
>probe:Drosophila_2:1634091_at:109:619; Interrogation_Position=444; Antisense; TGCTCCAGTGGCCAAGCTTTTCGTC
>probe:Drosophila_2:1634091_at:350:1; Interrogation_Position=459; Antisense; GCTTTTCGTCCCAGAGAACCAGTAT
>probe:Drosophila_2:1634091_at:603:379; Interrogation_Position=474; Antisense; GAACCAGTATGGCAACCAGTACGTT
>probe:Drosophila_2:1634091_at:520:89; Interrogation_Position=491; Antisense; AGTACGTTAGCCAGTACTCTGCACC
>probe:Drosophila_2:1634091_at:438:347; Interrogation_Position=53; Antisense; GCATCGTGGGCAGCTGCTACGCCAA
>probe:Drosophila_2:1634091_at:520:351; Interrogation_Position=90; Antisense; GCAGAGCTACGGACAGCGATCTTAC

Paste this into a BLAST search page for me
GCGATCTTACGGTCAGGATAGCTCCTGAACAAGTTCGCTACTCTGGCAGTAGGGTCAGCAGCGTTATGAGCGCCCATGAGCGCCCCGTGGAGATCATCGCTCCCATCCAGGTCAGCGGTGGATATTACAACGGTGGCAACTACCGTCGTGGAACAACTACAAGGCTTACGTCTCGAGTACAGCAAGGTGATCCTGCCCATTGCTCCAGTGGCCAAGCTTTTCGTCGCTTTTCGTCCCAGAGAACCAGTATGAACCAGTATGGCAACCAGTACGTTAGTACGTTAGCCAGTACTCTGCACCGCATCGTGGGCAGCTGCTACGCCAAGCAGAGCTACGGACAGCGATCTTAC

Full Affymetrix probeset data:

Annotations for 1634091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720