Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634092_at:

>probe:Drosophila_2:1634092_at:116:721; Interrogation_Position=7928; Antisense; TTGTTATGCAATATTTACCCTCCCC
>probe:Drosophila_2:1634092_at:9:307; Interrogation_Position=7972; Antisense; CCTCCTCCCATTTGTGTTATTGTAT
>probe:Drosophila_2:1634092_at:236:291; Interrogation_Position=8019; Antisense; CGTACTACGTAGTTAGCTTTCGAAT
>probe:Drosophila_2:1634092_at:68:393; Interrogation_Position=8063; Antisense; GAAACCATGCTAACGTGTTGCAATT
>probe:Drosophila_2:1634092_at:275:513; Interrogation_Position=8077; Antisense; GTGTTGCAATTTCTACTACCTTTTA
>probe:Drosophila_2:1634092_at:550:107; Interrogation_Position=8137; Antisense; AGAACGACACAGACCCAGATATCCA
>probe:Drosophila_2:1634092_at:477:457; Interrogation_Position=8154; Antisense; GATATCCACACACATAGAGCGCTAG
>probe:Drosophila_2:1634092_at:237:279; Interrogation_Position=8188; Antisense; CTAACAATAGCAAGGGACCGTCCCG
>probe:Drosophila_2:1634092_at:635:523; Interrogation_Position=8212; Antisense; GGGATGGTTCTCTACCAACTAACGA
>probe:Drosophila_2:1634092_at:441:313; Interrogation_Position=8248; Antisense; GCCAGAGTTACTATCGCTGACTGAA
>probe:Drosophila_2:1634092_at:281:573; Interrogation_Position=8280; Antisense; GGCGGGACAACCCAAGACGTACTGT
>probe:Drosophila_2:1634092_at:703:209; Interrogation_Position=8293; Antisense; AAGACGTACTGTTCATTCAACCAAA
>probe:Drosophila_2:1634092_at:264:395; Interrogation_Position=8330; Antisense; GAAATCATCCATCAAGGTCAGGCGA
>probe:Drosophila_2:1634092_at:200:535; Interrogation_Position=8345; Antisense; GGTCAGGCGATTGCGATTACGTAAA

Paste this into a BLAST search page for me
TTGTTATGCAATATTTACCCTCCCCCCTCCTCCCATTTGTGTTATTGTATCGTACTACGTAGTTAGCTTTCGAATGAAACCATGCTAACGTGTTGCAATTGTGTTGCAATTTCTACTACCTTTTAAGAACGACACAGACCCAGATATCCAGATATCCACACACATAGAGCGCTAGCTAACAATAGCAAGGGACCGTCCCGGGGATGGTTCTCTACCAACTAACGAGCCAGAGTTACTATCGCTGACTGAAGGCGGGACAACCCAAGACGTACTGTAAGACGTACTGTTCATTCAACCAAAGAAATCATCCATCAAGGTCAGGCGAGGTCAGGCGATTGCGATTACGTAAA

Full Affymetrix probeset data:

Annotations for 1634092_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime