Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634093_at:

>probe:Drosophila_2:1634093_at:701:209; Interrogation_Position=2502; Antisense; AAGAACGTATCTGATCTAGATCTGA
>probe:Drosophila_2:1634093_at:346:365; Interrogation_Position=2525; Antisense; GAATCATTCTGAAGTCACCTAGTGT
>probe:Drosophila_2:1634093_at:433:495; Interrogation_Position=2538; Antisense; GTCACCTAGTGTTCATTCACAACAT
>probe:Drosophila_2:1634093_at:666:387; Interrogation_Position=2602; Antisense; GAAACAGTTAAAACGCTGAGGTAAG
>probe:Drosophila_2:1634093_at:46:493; Interrogation_Position=2656; Antisense; GTAAAATAAGCATCAGGATCGCTGA
>probe:Drosophila_2:1634093_at:457:647; Interrogation_Position=2668; Antisense; TCAGGATCGCTGATATGTCATAAAA
>probe:Drosophila_2:1634093_at:337:43; Interrogation_Position=2682; Antisense; ATGTCATAAAAACTATCGTCGGTAA
>probe:Drosophila_2:1634093_at:479:377; Interrogation_Position=2720; Antisense; GAAGCTAGAAAACGCATGGTGTATA
>probe:Drosophila_2:1634093_at:381:179; Interrogation_Position=2750; Antisense; AAACATGTACGTGCTTGTAGTGCTT
>probe:Drosophila_2:1634093_at:456:139; Interrogation_Position=2758; Antisense; ACGTGCTTGTAGTGCTTGTATGAAA
>probe:Drosophila_2:1634093_at:298:397; Interrogation_Position=2855; Antisense; GACAATATGATGCTTTTTATCAGTA
>probe:Drosophila_2:1634093_at:403:89; Interrogation_Position=2901; Antisense; AGTCAGCAAGTAAACATCATCACAA
>probe:Drosophila_2:1634093_at:600:183; Interrogation_Position=2924; Antisense; AAAAGTTCTGAAGTTGTCTACGCAT
>probe:Drosophila_2:1634093_at:176:285; Interrogation_Position=2931; Antisense; CTGAAGTTGTCTACGCATGGTTGGG

Paste this into a BLAST search page for me
AAGAACGTATCTGATCTAGATCTGAGAATCATTCTGAAGTCACCTAGTGTGTCACCTAGTGTTCATTCACAACATGAAACAGTTAAAACGCTGAGGTAAGGTAAAATAAGCATCAGGATCGCTGATCAGGATCGCTGATATGTCATAAAAATGTCATAAAAACTATCGTCGGTAAGAAGCTAGAAAACGCATGGTGTATAAAACATGTACGTGCTTGTAGTGCTTACGTGCTTGTAGTGCTTGTATGAAAGACAATATGATGCTTTTTATCAGTAAGTCAGCAAGTAAACATCATCACAAAAAAGTTCTGAAGTTGTCTACGCATCTGAAGTTGTCTACGCATGGTTGGG

Full Affymetrix probeset data:

Annotations for 1634093_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime