FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634095_at:

>probe:Drosophila_2:1634095_at:207:95; Interrogation_Position=361; Antisense; AGTTGGCCGGTGGAAAGCCCACAGT
>probe:Drosophila_2:1634095_at:271:451; Interrogation_Position=429; Antisense; GATCTATTCGGATCCGACGACGAGG
>probe:Drosophila_2:1634095_at:719:93; Interrogation_Position=488; Antisense; AGTTGCCGCTTACGCCGCCAAGAAG
>probe:Drosophila_2:1634095_at:499:105; Interrogation_Position=508; Antisense; AGAAGTCTAAGAAACCCGCCCTCAT
>probe:Drosophila_2:1634095_at:334:645; Interrogation_Position=529; Antisense; TCATTGCCAAGTCGTCGGTGCTCCT
>probe:Drosophila_2:1634095_at:335:629; Interrogation_Position=550; Antisense; TCCTCGATGTCAAGCCCTGGGATGA
>probe:Drosophila_2:1634095_at:191:125; Interrogation_Position=562; Antisense; AGCCCTGGGATGACGAGACCGACAT
>probe:Drosophila_2:1634095_at:448:185; Interrogation_Position=600; Antisense; AACAATGTCCGCACCATCGAAATGG
>probe:Drosophila_2:1634095_at:663:177; Interrogation_Position=648; Antisense; AAACTGGTCCCAGTCGGCTATGGCA
>probe:Drosophila_2:1634095_at:71:89; Interrogation_Position=659; Antisense; AGTCGGCTATGGCATCAACAAGTTG
>probe:Drosophila_2:1634095_at:706:251; Interrogation_Position=677; Antisense; CAAGTTGCAGATCATGTGCGTCATC
>probe:Drosophila_2:1634095_at:7:75; Interrogation_Position=703; Antisense; AGGACGACAAGGTGTCCATCGATTT
>probe:Drosophila_2:1634095_at:108:435; Interrogation_Position=753; Antisense; GAGGACTTTGTTCAGTCTGTCGACA
>probe:Drosophila_2:1634095_at:662:87; Interrogation_Position=766; Antisense; AGTCTGTCGACATTGCTGCCTTCAA

Paste this into a BLAST search page for me
AGTTGGCCGGTGGAAAGCCCACAGTGATCTATTCGGATCCGACGACGAGGAGTTGCCGCTTACGCCGCCAAGAAGAGAAGTCTAAGAAACCCGCCCTCATTCATTGCCAAGTCGTCGGTGCTCCTTCCTCGATGTCAAGCCCTGGGATGAAGCCCTGGGATGACGAGACCGACATAACAATGTCCGCACCATCGAAATGGAAACTGGTCCCAGTCGGCTATGGCAAGTCGGCTATGGCATCAACAAGTTGCAAGTTGCAGATCATGTGCGTCATCAGGACGACAAGGTGTCCATCGATTTGAGGACTTTGTTCAGTCTGTCGACAAGTCTGTCGACATTGCTGCCTTCAA

Full Affymetrix probeset data:

Annotations for 1634095_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720