Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634096_at:

>probe:Drosophila_2:1634096_at:465:427; Interrogation_Position=1646; Antisense; GAGATCTTTGGACCGGTTCAGCAGC
>probe:Drosophila_2:1634096_at:511:649; Interrogation_Position=1663; Antisense; TCAGCAGCTGATCCGCTTCAAGAAG
>probe:Drosophila_2:1634096_at:222:407; Interrogation_Position=1703; Antisense; GAGCGGGCTAACAACTCCGAGTACG
>probe:Drosophila_2:1634096_at:503:317; Interrogation_Position=1739; Antisense; GCCGTTTTCACCAAGGATCTGGACA
>probe:Drosophila_2:1634096_at:280:255; Interrogation_Position=1768; Antisense; CAACTACATTGTGGGTGGCCTGCGT
>probe:Drosophila_2:1634096_at:692:529; Interrogation_Position=1806; Antisense; GGGTAAACACCTACAATGTCCTCGC
>probe:Drosophila_2:1634096_at:662:569; Interrogation_Position=1837; Antisense; GGCTCCGTTCGGTGGCTACAAGATG
>probe:Drosophila_2:1634096_at:419:99; Interrogation_Position=1857; Antisense; AGATGTCCGGCCATGGACGCGAGAA
>probe:Drosophila_2:1634096_at:656:425; Interrogation_Position=1884; Antisense; GAGAGTATGCTCTGTCCAACTACAC
>probe:Drosophila_2:1634096_at:7:103; Interrogation_Position=1917; Antisense; AGAGCGTCATCGTCAAGGTTGCCCA
>probe:Drosophila_2:1634096_at:717:525; Interrogation_Position=1980; Antisense; GGGACGCTTAATATGGTTCGCCCTA
>probe:Drosophila_2:1634096_at:459:705; Interrogation_Position=2006; Antisense; TTAGGTGCTCTAAATTCCGGCGATA
>probe:Drosophila_2:1634096_at:278:305; Interrogation_Position=2022; Antisense; CCGGCGATAATCTACATCTCTATAA
>probe:Drosophila_2:1634096_at:346:481; Interrogation_Position=2070; Antisense; GTTTGATATACCTAACTACGGCCAG

Paste this into a BLAST search page for me
GAGATCTTTGGACCGGTTCAGCAGCTCAGCAGCTGATCCGCTTCAAGAAGGAGCGGGCTAACAACTCCGAGTACGGCCGTTTTCACCAAGGATCTGGACACAACTACATTGTGGGTGGCCTGCGTGGGTAAACACCTACAATGTCCTCGCGGCTCCGTTCGGTGGCTACAAGATGAGATGTCCGGCCATGGACGCGAGAAGAGAGTATGCTCTGTCCAACTACACAGAGCGTCATCGTCAAGGTTGCCCAGGGACGCTTAATATGGTTCGCCCTATTAGGTGCTCTAAATTCCGGCGATACCGGCGATAATCTACATCTCTATAAGTTTGATATACCTAACTACGGCCAG

Full Affymetrix probeset data:

Annotations for 1634096_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime