FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634100_at:

>probe:Drosophila_2:1634100_at:27:429; Interrogation_Position=1028; Antisense; GAGATTTCTGTGTACATAGCTGGCA
>probe:Drosophila_2:1634100_at:253:27; Interrogation_Position=1043; Antisense; ATAGCTGGCACTTGCATGCGAAAGA
>probe:Drosophila_2:1634100_at:395:225; Interrogation_Position=639; Antisense; AAGGACTCCGACTATATTGTTCTAA
>probe:Drosophila_2:1634100_at:512:151; Interrogation_Position=667; Antisense; ACATGAAGAAGGCTTTCCAGTTTGC
>probe:Drosophila_2:1634100_at:445:91; Interrogation_Position=685; Antisense; AGTTTGCCCACAAGGCTTGCGAGCT
>probe:Drosophila_2:1634100_at:659:51; Interrogation_Position=721; Antisense; ATGCGTGTGCCAATCTTAGCCAGAT
>probe:Drosophila_2:1634100_at:119:379; Interrogation_Position=800; Antisense; GAAGCTGGCCCTAGAAATGCAGGAC
>probe:Drosophila_2:1634100_at:25:29; Interrogation_Position=844; Antisense; ATACGTTAGGGTTCCAGCAGGGCGT
>probe:Drosophila_2:1634100_at:510:267; Interrogation_Position=861; Antisense; CAGGGCGTGGGCATGCCTAATTGAT
>probe:Drosophila_2:1634100_at:158:465; Interrogation_Position=893; Antisense; GATTCCTGATATTATCTGCTGCTAC
>probe:Drosophila_2:1634100_at:80:333; Interrogation_Position=910; Antisense; GCTGCTACTGTTTTTAGACCTTGCT
>probe:Drosophila_2:1634100_at:337:275; Interrogation_Position=933; Antisense; CTTCAGGTCAGGTCAGGTTTTTCTT
>probe:Drosophila_2:1634100_at:483:673; Interrogation_Position=958; Antisense; TACCTTCTAGCCCTTTTCAGTAATT
>probe:Drosophila_2:1634100_at:543:697; Interrogation_Position=972; Antisense; TTTCAGTAATTTTCAGTCAGTCTAA

Paste this into a BLAST search page for me
GAGATTTCTGTGTACATAGCTGGCAATAGCTGGCACTTGCATGCGAAAGAAAGGACTCCGACTATATTGTTCTAAACATGAAGAAGGCTTTCCAGTTTGCAGTTTGCCCACAAGGCTTGCGAGCTATGCGTGTGCCAATCTTAGCCAGATGAAGCTGGCCCTAGAAATGCAGGACATACGTTAGGGTTCCAGCAGGGCGTCAGGGCGTGGGCATGCCTAATTGATGATTCCTGATATTATCTGCTGCTACGCTGCTACTGTTTTTAGACCTTGCTCTTCAGGTCAGGTCAGGTTTTTCTTTACCTTCTAGCCCTTTTCAGTAATTTTTCAGTAATTTTCAGTCAGTCTAA

Full Affymetrix probeset data:

Annotations for 1634100_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720