Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634101_at:

>probe:Drosophila_2:1634101_at:585:111; Interrogation_Position=1943; Antisense; AGCAACAGGCACAAACGATCTCCAC
>probe:Drosophila_2:1634101_at:307:545; Interrogation_Position=1977; Antisense; GGATCGCACATTAACCGGCGGATTT
>probe:Drosophila_2:1634101_at:264:561; Interrogation_Position=2013; Antisense; GGAAGTATGATATCCGTACCAACGG
>probe:Drosophila_2:1634101_at:309:559; Interrogation_Position=2044; Antisense; GGACAGACGGACAGTTGGCAATCAT
>probe:Drosophila_2:1634101_at:519:565; Interrogation_Position=2104; Antisense; GGCAAGCGGGCATTGATTGCGCCAT
>probe:Drosophila_2:1634101_at:251:301; Interrogation_Position=2130; Antisense; CCCTGTCATCCAGCACAATGTATAA
>probe:Drosophila_2:1634101_at:237:339; Interrogation_Position=2210; Antisense; GCTAGTGTCTAAGTCGTAGGCATCT
>probe:Drosophila_2:1634101_at:117:723; Interrogation_Position=2255; Antisense; TTGTAATTTATTGCTGACCCTCCCG
>probe:Drosophila_2:1634101_at:563:249; Interrogation_Position=2288; Antisense; CAGCAGGTTTCACCTTCTCCAAAAA
>probe:Drosophila_2:1634101_at:387:629; Interrogation_Position=2327; Antisense; TCCACCACTTTTAAACCTAGCACTT
>probe:Drosophila_2:1634101_at:578:609; Interrogation_Position=2400; Antisense; TGACGGATGCCACCGGTCCAAAGCA
>probe:Drosophila_2:1634101_at:217:253; Interrogation_Position=2418; Antisense; CAAAGCATAACCCAGCGTTTCGCGT
>probe:Drosophila_2:1634101_at:62:633; Interrogation_Position=2447; Antisense; TCCGCGCTCTTTATTATGTATTTGT
>probe:Drosophila_2:1634101_at:4:205; Interrogation_Position=2507; Antisense; AAGCCACCAAGGACTATGTGCCAGA

Paste this into a BLAST search page for me
AGCAACAGGCACAAACGATCTCCACGGATCGCACATTAACCGGCGGATTTGGAAGTATGATATCCGTACCAACGGGGACAGACGGACAGTTGGCAATCATGGCAAGCGGGCATTGATTGCGCCATCCCTGTCATCCAGCACAATGTATAAGCTAGTGTCTAAGTCGTAGGCATCTTTGTAATTTATTGCTGACCCTCCCGCAGCAGGTTTCACCTTCTCCAAAAATCCACCACTTTTAAACCTAGCACTTTGACGGATGCCACCGGTCCAAAGCACAAAGCATAACCCAGCGTTTCGCGTTCCGCGCTCTTTATTATGTATTTGTAAGCCACCAAGGACTATGTGCCAGA

Full Affymetrix probeset data:

Annotations for 1634101_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime