Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634102_at:

>probe:Drosophila_2:1634102_at:172:319; Interrogation_Position=54034; Antisense; GCCGTCACCGAGAGCATATCGCTTA
>probe:Drosophila_2:1634102_at:313:21; Interrogation_Position=54049; Antisense; ATATCGCTTAAGACACATGCTAGTG
>probe:Drosophila_2:1634102_at:451:299; Interrogation_Position=54177; Antisense; CGCCAATGCCCACATATTCGAATGG
>probe:Drosophila_2:1634102_at:189:571; Interrogation_Position=54238; Antisense; GGCTACCACATTGCTATACGGGACA
>probe:Drosophila_2:1634102_at:500:309; Interrogation_Position=54298; Antisense; CCAGCTGGCGTGCTGAAGTTCCAGA
>probe:Drosophila_2:1634102_at:582:451; Interrogation_Position=54328; Antisense; GATCTGCAGGAGAACCACGAGTACA
>probe:Drosophila_2:1634102_at:334:281; Interrogation_Position=54395; Antisense; CTCTGGAATCGGAGGAGCCCTACAA
>probe:Drosophila_2:1634102_at:470:609; Interrogation_Position=54425; Antisense; TGACTGCTGGTCATGAGAGCCTGCC
>probe:Drosophila_2:1634102_at:335:409; Interrogation_Position=54451; Antisense; GACGAGCCGCGTACAGAGATGAGTT
>probe:Drosophila_2:1634102_at:175:445; Interrogation_Position=54468; Antisense; GATGAGTTCGTGCAATACCTCCTCG
>probe:Drosophila_2:1634102_at:687:521; Interrogation_Position=54492; Antisense; GTGGCTGCGTGACCATCACATGGAT
>probe:Drosophila_2:1634102_at:450:51; Interrogation_Position=54515; Antisense; ATGCGGATATCCATTCGTATGCCCG
>probe:Drosophila_2:1634102_at:214:349; Interrogation_Position=54542; Antisense; GCAGGCTGCTTCAACGCGATGAGTA
>probe:Drosophila_2:1634102_at:101:57; Interrogation_Position=54560; Antisense; ATGAGTACTTCTTCCGGTTGTGGGC

Paste this into a BLAST search page for me
GCCGTCACCGAGAGCATATCGCTTAATATCGCTTAAGACACATGCTAGTGCGCCAATGCCCACATATTCGAATGGGGCTACCACATTGCTATACGGGACACCAGCTGGCGTGCTGAAGTTCCAGAGATCTGCAGGAGAACCACGAGTACACTCTGGAATCGGAGGAGCCCTACAATGACTGCTGGTCATGAGAGCCTGCCGACGAGCCGCGTACAGAGATGAGTTGATGAGTTCGTGCAATACCTCCTCGGTGGCTGCGTGACCATCACATGGATATGCGGATATCCATTCGTATGCCCGGCAGGCTGCTTCAACGCGATGAGTAATGAGTACTTCTTCCGGTTGTGGGC

Full Affymetrix probeset data:

Annotations for 1634102_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime