FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634103_at:

>probe:Drosophila_2:1634103_at:500:19; Interrogation_Position=1133; Antisense; ATTTGGGTAGCATCCTCACGGTGAA
>probe:Drosophila_2:1634103_at:719:55; Interrogation_Position=1187; Antisense; ATGACATAGTGAGTGCCCAGTTGCC
>probe:Drosophila_2:1634103_at:415:301; Interrogation_Position=1202; Antisense; CCCAGTTGCCCGTCATGATTATTGA
>probe:Drosophila_2:1634103_at:235:613; Interrogation_Position=1253; Antisense; TGAACAAGGAGTTGCCCCAGGAGTT
>probe:Drosophila_2:1634103_at:116:269; Interrogation_Position=1270; Antisense; CAGGAGTTTTTGGAGCTTCTACGCC
>probe:Drosophila_2:1634103_at:547:11; Interrogation_Position=1301; Antisense; ATTCGGCAGTATTCTCGGAGCACCA
>probe:Drosophila_2:1634103_at:586:239; Interrogation_Position=1336; Antisense; AATAGCTCCTTTGCCTATTTCGTCA
>probe:Drosophila_2:1634103_at:227:545; Interrogation_Position=1365; Antisense; GGATCACTGGGAGTTCCTCGACGAA
>probe:Drosophila_2:1634103_at:662:113; Interrogation_Position=1406; Antisense; AGCAGCGACTCTTCAAGCTAAGCTC
>probe:Drosophila_2:1634103_at:717:205; Interrogation_Position=1425; Antisense; AAGCTCAATTTGCTTTGGCTCCTAC
>probe:Drosophila_2:1634103_at:531:573; Interrogation_Position=1487; Antisense; GGCGGGACATCGAGTACTTCACGTT
>probe:Drosophila_2:1634103_at:337:9; Interrogation_Position=1520; Antisense; ATTCTTCGGGACTTCTCAACTTCTA
>probe:Drosophila_2:1634103_at:722:75; Interrogation_Position=1607; Antisense; AGGAGTATACATCTGCTGGACTGCA
>probe:Drosophila_2:1634103_at:399:527; Interrogation_Position=1681; Antisense; GGGATCGTGTTTGTCCTGGAAACTC

Paste this into a BLAST search page for me
ATTTGGGTAGCATCCTCACGGTGAAATGACATAGTGAGTGCCCAGTTGCCCCCAGTTGCCCGTCATGATTATTGATGAACAAGGAGTTGCCCCAGGAGTTCAGGAGTTTTTGGAGCTTCTACGCCATTCGGCAGTATTCTCGGAGCACCAAATAGCTCCTTTGCCTATTTCGTCAGGATCACTGGGAGTTCCTCGACGAAAGCAGCGACTCTTCAAGCTAAGCTCAAGCTCAATTTGCTTTGGCTCCTACGGCGGGACATCGAGTACTTCACGTTATTCTTCGGGACTTCTCAACTTCTAAGGAGTATACATCTGCTGGACTGCAGGGATCGTGTTTGTCCTGGAAACTC

Full Affymetrix probeset data:

Annotations for 1634103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720