FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634106_at:

>probe:Drosophila_2:1634106_at:439:165; Interrogation_Position=117; Antisense; AAATCCACTGTGGTTCGTCTTCTGG
>probe:Drosophila_2:1634106_at:300:583; Interrogation_Position=139; Antisense; TGGCTGCTGGTCTTCTGGTTCGTCT
>probe:Drosophila_2:1634106_at:42:649; Interrogation_Position=14; Antisense; TCAGTCTTCATTCCATTCTCGAATC
>probe:Drosophila_2:1634106_at:184:589; Interrogation_Position=154; Antisense; TGGTTCGTCTCCTTCTTCGTGGCAT
>probe:Drosophila_2:1634106_at:450:11; Interrogation_Position=177; Antisense; ATTCTTCTGCGCCTTTTTCTACATC
>probe:Drosophila_2:1634106_at:285:713; Interrogation_Position=193; Antisense; TTCTACATCTGGGTCTACGCATTTG
>probe:Drosophila_2:1634106_at:78:305; Interrogation_Position=234; Antisense; CCTGACGGGCATATCGGACATTCTG
>probe:Drosophila_2:1634106_at:580:23; Interrogation_Position=244; Antisense; ATATCGGACATTCTGCTCCAGGGAG
>probe:Drosophila_2:1634106_at:259:79; Interrogation_Position=263; Antisense; AGGGAGTCCAGTTCCCGTTCTACTG
>probe:Drosophila_2:1634106_at:139:473; Interrogation_Position=279; Antisense; GTTCTACTGCGGGAAAGCCATGTTA
>probe:Drosophila_2:1634106_at:127:507; Interrogation_Position=356; Antisense; GTGCCTTACTGATAACTCTTGTTTT
>probe:Drosophila_2:1634106_at:390:449; Interrogation_Position=57; Antisense; GATCCGATCGTCTACTTGCTGAAAT
>probe:Drosophila_2:1634106_at:723:43; Interrogation_Position=80; Antisense; ATCGCTCTGAACAAACAACACCACT
>probe:Drosophila_2:1634106_at:54:189; Interrogation_Position=96; Antisense; AACACCACTCATCACGATGCCAAAT

Paste this into a BLAST search page for me
AAATCCACTGTGGTTCGTCTTCTGGTGGCTGCTGGTCTTCTGGTTCGTCTTCAGTCTTCATTCCATTCTCGAATCTGGTTCGTCTCCTTCTTCGTGGCATATTCTTCTGCGCCTTTTTCTACATCTTCTACATCTGGGTCTACGCATTTGCCTGACGGGCATATCGGACATTCTGATATCGGACATTCTGCTCCAGGGAGAGGGAGTCCAGTTCCCGTTCTACTGGTTCTACTGCGGGAAAGCCATGTTAGTGCCTTACTGATAACTCTTGTTTTGATCCGATCGTCTACTTGCTGAAATATCGCTCTGAACAAACAACACCACTAACACCACTCATCACGATGCCAAAT

Full Affymetrix probeset data:

Annotations for 1634106_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720